View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16265_low_19 (Length: 389)

Name: NF16265_low_19
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16265_low_19
NF16265_low_19
[»] chr8 (2 HSPs)
chr8 (9-226)||(41077586-41077803)
chr8 (261-368)||(41077444-41077551)
[»] chr5 (1 HSPs)
chr5 (117-149)||(19110715-19110747)
[»] chr1 (1 HSPs)
chr1 (99-151)||(43459467-43459519)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 41077803 - 41077586
Alignment:
9 agcagagaaaactatgtaaaagtagaagactcgtaaaagggtgtgtcttgcacaattttatgtgtaagttggagtgaggtggtttaataggggaggtgat 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
41077803 agcagagaaaactatgtaaaagtagaagactcgtaaaagggtgtgtcttgcacaattttatgcgtaagttggagtgaggtggtttaataggggaggtgat 41077704  T
109 gaggaagttggggaatggtatggatacttgtttttggaaggatagggtggttgccaaatgggccgctttgtgatcgtttccctcagctattttcgataac 208  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41077703 gaggaagttgggaaatggtatggatacttgtttttggaaggatagggtggttgccaaatgggccgctttgtgatcgtttccctcagctattttcgataac 41077604  T
209 cttggagaaagatattaa 226  Q
    ||||||||||||||||||    
41077603 cttggagaaagatattaa 41077586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 261 - 368
Target Start/End: Complemental strand, 41077551 - 41077444
Alignment:
261 acgagatggtcttttcaatgtgggagtcggagcttttgcaagagcctcgagagggcttagtaggtgtagtggtgggggagggtgaggatgtgtggtggtg 360  Q
    ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||    
41077551 acgagatggtcttttcaatgtgggagttggagcttttgcaagagcttcgagagggcttagtaggtgtagtggtgggggagggtgaggatgtgcggtggtg 41077452  T
361 gaaatccg 368  Q
    ||||||||    
41077451 gaaatccg 41077444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 117 - 149
Target Start/End: Complemental strand, 19110747 - 19110715
Alignment:
117 tggggaatggtatggatacttgtttttggaagg 149  Q
    |||||||||||||||||||| ||||||||||||    
19110747 tggggaatggtatggatactagtttttggaagg 19110715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 43459467 - 43459519
Alignment:
99 gggaggtgatgaggaagttggggaatggtatggatacttgtttttggaaggat 151  Q
    ||||||| ||||||||| |||||||||||  ||||||  ||||||||||||||    
43459467 gggaggttatgaggaaggtggggaatggtggggatacgcgtttttggaaggat 43459519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University