View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_20 (Length: 385)
Name: NF16265_low_20
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 121 - 368
Target Start/End: Complemental strand, 34341083 - 34340836
Alignment:
| Q |
121 |
atggaagggagaaagagtgctcagtagtgtttgttgaattacggacatagaacctaaggaccaaattctcctccgggacttacccttttcaattgataac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34341083 |
atggaagggagaaagagtgctcagtagtgtttgttgaattacggacatagaacctaaggaccaaattctcctccgggacttacccttttcaattgataac |
34340984 |
T |
 |
| Q |
221 |
aaggttcctctacctgtacctccccttatttaatgtaactaatcttgctgtcaaaactcaaaactacctatttttgtttgtaattggtgattctcaaaat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340983 |
aaggttcctctacctgtacctccccttatttaatgtaactaatcttgctgtcaaaactcaaaactacctatttttgtttgtaattggtgattctcaaaat |
34340884 |
T |
 |
| Q |
321 |
tgataagggtatgcttaacgatttcttttatttctttatgcagcttcc |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340883 |
tgataagggtatgcttaacgatttcttttatttctttatgcagcttcc |
34340836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 8467244 - 8467171
Alignment:
| Q |
3 |
cagagaagaaattagtctatcaggaaggcattacaaaaagaagccaacagaaggctgttggcagtatgtccacc |
76 |
Q |
| |
|
|||| |||||| |||| |||||||||||| ||||||| |||||| ||||| | |||||||||||||| ||||| |
|
|
| T |
8467244 |
cagataagaaaatagtatatcaggaaggctttacaaagagaagctaacagtggtctgttggcagtatgcccacc |
8467171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University