View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_26 (Length: 339)
Name: NF16265_low_26
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 17 - 302
Target Start/End: Original strand, 10333587 - 10333873
Alignment:
| Q |
17 |
gacgagagatggaaggatggttagaatgtgaaatgggttgatcttgtgcggaaagtgcgccataaataattactacgaaccacatgttgtaatagtctat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10333587 |
gacgagagatggaaggatggttagaatgtgagatgggttgatcttgttcggaaagtgcgccataaataattactacgaaccacatgttgtaatagtctat |
10333686 |
T |
|
| Q |
117 |
gatacaaaagtttaatttacttctctcttctctcnnnnnnnnngaagtttaatttactaaattttcttcaaagatattctatggaaaatatatgttcaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10333687 |
gatacaaaagtttaatttacttctctcttctctcaaaaagaa--aagtttaatttactaaattttcttcaaagatattctatggaaaatatatgttcaca |
10333784 |
T |
|
| Q |
217 |
cttctagttatactggtcatatc--nnnnnnntgtataggtatacagtttcttt-gataaggtcatggagaacttcatcaacacttttt |
302 |
Q |
| |
|
|||||||||||||||| |||| | ||| |||||||||||||| ||| ||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
10333785 |
cttctagttatactggccataccaaaaaaaaatgtctaggtatacagtttttttggataaggtcattgagaagttcatcagcacttttt |
10333873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University