View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_30 (Length: 306)
Name: NF16265_low_30
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 120 - 291
Target Start/End: Complemental strand, 5670545 - 5670374
Alignment:
| Q |
120 |
gagaatttttataaattttagtaaagtggcggtaaagatctgtgatgagattaagggggtttcttggagatggagtttaatgaggttgaaggaaaccccg |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5670545 |
gagaatttttataaattttaggaaagtggcggtaaagatctgtgatgagattaagggggtttcttggagatggagtttaatgaggttgaaggaaaccccg |
5670446 |
T |
 |
| Q |
220 |
tccatattttatgactggtgattgcctcatgaggtagagggtgtgtcttttagagcttcttctggttattcc |
291 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5670445 |
tccatattttatgactgttgattgcctcatgaggtagagggtgtgtcttttagaggttcttctggttattcc |
5670374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 120 - 291
Target Start/End: Complemental strand, 5680038 - 5679867
Alignment:
| Q |
120 |
gagaatttttataaattttagtaaagtggcggtaaagatctgtgatgagattaagggggtttcttggagatggagtttaatgaggttgaaggaaaccccg |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680038 |
gagaatttttataaattttaggaaagtggcggtaaagatctgtgatgaaattaaggtggtttcttggagatggagtttaatgaggttgaaggaaaccccg |
5679939 |
T |
 |
| Q |
220 |
tccatattttatgactggtgattgcctcatgaggtagagggtgtgtcttttagagcttcttctggttattcc |
291 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
5679938 |
tccttattttatgactggtgattgcctcatgaggtagagggtgtgtcttttcgaggttcttctggttattcc |
5679867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 181 - 291
Target Start/End: Complemental strand, 5694153 - 5694043
Alignment:
| Q |
181 |
tcttggagatggagtttaatgaggttgaaggaaaccccgtccatattttatgactggtgattgcctcatgaggtagagggtgtgtcttttagagcttctt |
280 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5694153 |
tcttggagatggagtttaatgaggctgaaggaaaccccgtccatattttatgactggtgattgcctcatgaggtagagggtgtgtcttttagaggttctt |
5694054 |
T |
 |
| Q |
281 |
ctggttattcc |
291 |
Q |
| |
|
||||||||||| |
|
|
| T |
5694053 |
ctggttattcc |
5694043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 5736299 - 5736219
Alignment:
| Q |
1 |
tctctcagggaatttctatttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagataatagagaatac |
81 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5736299 |
tctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaatac |
5736219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 5773411 - 5773331
Alignment:
| Q |
1 |
tctctcagggaatttctatttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagataatagagaatac |
81 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5773411 |
tctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaatac |
5773331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 120 - 239
Target Start/End: Complemental strand, 5793748 - 5793629
Alignment:
| Q |
120 |
gagaatttttataaattttagtaaagtggcg--gtaaagatctgtgatgagattaagggggtttcttggagatggagtttaatgaggttgaaggaaaccc |
217 |
Q |
| |
|
|||||||||||||||||||| || |||| | ||| || ||| |||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
5793748 |
gagaatttttataaattttacaaaggtggtgtggtagaggtctttgatgagattaagggggtttcttgagaatggagtttaatgaggttgaaggaa--cc |
5793651 |
T |
 |
| Q |
218 |
cgtccatattttatgactggtg |
239 |
Q |
| |
|
||||| |||||||||| ||||| |
|
|
| T |
5793650 |
cgtccttattttatgagtggtg |
5793629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 5697649 - 5697569
Alignment:
| Q |
1 |
tctctcagggaatttct---atttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagataatagagaa |
78 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
5697649 |
tctctcagggaatttcttctacttgccatgttaattgtggtaaagtgtgggaaacaacaattataccaagaaattagagaa |
5697569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 5694191 - 5694151
Alignment:
| Q |
120 |
gagaatttttataaattttagtaaagtggcggtaaagatct |
160 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
5694191 |
gagaatttttataaattttaggaaagtggtggtaaagatct |
5694151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 9430903 - 9430958
Alignment:
| Q |
162 |
tgatgagattaagggggtttcttggagatggagtttaatgaggttgaaggaaaccc |
217 |
Q |
| |
|
|||||| || |||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9430903 |
tgatgaaataaaggtggtttcttggagatggactttaatgaggttgaaggtaaccc |
9430958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 218
Target Start/End: Original strand, 9420194 - 9420240
Alignment:
| Q |
172 |
aagggggtttcttggagatggagtttaatgaggttgaaggaaacccc |
218 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
9420194 |
aaggtggtttcttggagatagggtttaatgaggttgaaggtaacccc |
9420240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 41482158 - 41482203
Alignment:
| Q |
12 |
atttctatttgccatgttaattgtggtgaagtgtgggaaacaacaa |
57 |
Q |
| |
|
||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
41482158 |
atttctacttgctatgtttattgtggtgaagtgtgggaaacaacaa |
41482203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University