View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_41 (Length: 248)
Name: NF16265_low_41
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 190
Target Start/End: Complemental strand, 13049497 - 13049317
Alignment:
| Q |
9 |
attatacttatgatccgttaacttaatttttattttaatgtcatgactaatatttgttttgtttaagtcccttaactctacttt--tcagccaagtttat |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
13049497 |
attatatttatgatccgttaacttaatttttattttagtgtcatgactaatatttgttttgtttaagtcccttaactctacttttataagccaagtttat |
13049398 |
T |
|
| Q |
107 |
cccttctattagtttttgtnnnnnnnnnnnnttaataataaagttaacatttgtccacttatcatgtaggattggtgattcctc |
190 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13049397 |
cccttctattagtttttgtaaaaaaaacaa---aaaaaaaaagttaacatttgtccacttatcatgtaggattggtgattcctc |
13049317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University