View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_43 (Length: 239)
Name: NF16265_low_43
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38326610 - 38326398
Alignment:
| Q |
1 |
ataacaattttgtttggtctagttcaattttattctcaaacacaacaatagtctagttaatgtgactatctctctagacctctagttgcattcttttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38326610 |
ataacaattttgtttggtctagttcaattttattctcaaacacaacaatagtctagttaatgtgactatctctctag--------ttgcattcttttaaa |
38326519 |
T |
 |
| Q |
101 |
cagtaaaccaagggtggtgggtatgtgaagaagttagaatgcaatcaattttgataaaatttagcagaacaagtccagatcattttgcatgtttactatc |
200 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326518 |
cagtaaaccaagggtagagggtatgtgaagaagttagaatgcaatcaattttgataaaatttagcagaacaagtccagatcattttgcatgtttactatc |
38326419 |
T |
 |
| Q |
201 |
taagatatttatgactacacg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38326418 |
taagatatttatgactacacg |
38326398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University