View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_48 (Length: 226)
Name: NF16265_low_48
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 65 - 208
Target Start/End: Complemental strand, 10334023 - 10333880
Alignment:
| Q |
65 |
aagaagtagagaaaaagatccatgttattcaaaccagattaaagcaacaggccacactgatatttagatgaataaagaaaaagtaactcaaatagagcta |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
10334023 |
aagaagtagagaaaaagatccatgttattcaaacgagattaaagcaacaggccacactgatatttagatgaatcaagaaaaagtagctcaaatagagcta |
10333924 |
T |
 |
| Q |
165 |
gatgccgctcttgaaagagaatagagcacaacaaaattgataac |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10333923 |
gatgcagctcttgaaagagaatagagcacaacaaaattgataac |
10333880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University