View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_low_52 (Length: 204)
Name: NF16265_low_52
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 2588339 - 2588512
Alignment:
| Q |
13 |
tgaagaaggtttggaaagtttgtgttttgacggccattatcaaacacatgtctccaaatattcagaagattaagagtattgctagacgttcgaggagcct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2588339 |
tgaagaaggtttggaaagtttgtgttttgacggccattatcaaacatatgtctccaaatattcagaagattaagagtattgctagacgttcgaggagcct |
2588438 |
T |
|
| Q |
113 |
gcaaaatagattcactgctaaggatacagctatttggcttgctgttattgattatgaagaaagattggcaagag |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2588439 |
gcaaaatagattcactgctaaggatacagctatttggcttgctgttattgattatgaagaaagattggcaagag |
2588512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University