View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16266_high_13 (Length: 219)
Name: NF16266_high_13
Description: NF16266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16266_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 43592198 - 43592013
Alignment:
| Q |
19 |
ttgagaagtatgtgtttggggaaactccgagggatcgtttgaggaatttggagaatagaatatctcaaatggagaaaaccccaacttatagtcagatgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43592198 |
ttgagaagtatgtgtttggggaaactccgagggatcgtttgaggaatttggagaatagaatatctcaaatggagaaaaccccaacttatagtcagatgga |
43592099 |
T |
 |
| Q |
119 |
tggggatttcaatgggaaaaatgttatagagaaggtgatagttggacattctcctagaacgaataaacattcgaggaaattttcat |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43592098 |
tggggatttcaatgggaagaatgttatagagaaggtgatagttggacattctcctagaacgaataaacattcgaggaaattttcat |
43592013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 24017276 - 24017430
Alignment:
| Q |
18 |
attgagaagtatgtgtttggggaaactccgagggatcgtttgaggaatttggagaatagaatatctcaaatggagaaaaccccaacttatagtcagatgg |
117 |
Q |
| |
|
|||||||| |||| |||||||||||||| || |||||||||| ||||||||||| || ||||||||||||||||| || ||||| || ||| ||| |
|
|
| T |
24017276 |
attgagaaatatgcatttggggaaactcctgatgaccgtttgaggagcttggagaataggatttctcaaatggagaaaactcccacttacagccaggtgg |
24017375 |
T |
 |
| Q |
118 |
atggggatttcaatgggaaaaatgttatagagaaggtgatagttggacattctcc |
172 |
Q |
| |
|
|||| ||||| | ||| ||||||||| ||||| || || |||||||| ||||| |
|
|
| T |
24017376 |
atggtgattttattggaaaaaatgtttcggagaaagtaattgttggacaatctcc |
24017430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University