View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16266_high_13 (Length: 219)

Name: NF16266_high_13
Description: NF16266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16266_high_13
NF16266_high_13
[»] chr7 (1 HSPs)
chr7 (19-204)||(43592013-43592198)
[»] chr1 (1 HSPs)
chr1 (18-172)||(24017276-24017430)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 43592198 - 43592013
Alignment:
19 ttgagaagtatgtgtttggggaaactccgagggatcgtttgaggaatttggagaatagaatatctcaaatggagaaaaccccaacttatagtcagatgga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43592198 ttgagaagtatgtgtttggggaaactccgagggatcgtttgaggaatttggagaatagaatatctcaaatggagaaaaccccaacttatagtcagatgga 43592099  T
119 tggggatttcaatgggaaaaatgttatagagaaggtgatagttggacattctcctagaacgaataaacattcgaggaaattttcat 204  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43592098 tggggatttcaatgggaagaatgttatagagaaggtgatagttggacattctcctagaacgaataaacattcgaggaaattttcat 43592013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 24017276 - 24017430
Alignment:
18 attgagaagtatgtgtttggggaaactccgagggatcgtttgaggaatttggagaatagaatatctcaaatggagaaaaccccaacttatagtcagatgg 117  Q
    |||||||| ||||  ||||||||||||||    || ||||||||||  ||||||||||| || ||||||||||||||||| || ||||| || ||| |||    
24017276 attgagaaatatgcatttggggaaactcctgatgaccgtttgaggagcttggagaataggatttctcaaatggagaaaactcccacttacagccaggtgg 24017375  T
118 atggggatttcaatgggaaaaatgttatagagaaggtgatagttggacattctcc 172  Q
    |||| ||||| | ||| |||||||||   ||||| || || |||||||| |||||    
24017376 atggtgattttattggaaaaaatgtttcggagaaagtaattgttggacaatctcc 24017430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University