View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16266_low_8 (Length: 252)
Name: NF16266_low_8
Description: NF16266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16266_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 4039015 - 4039247
Alignment:
| Q |
1 |
aacgagccaatgatcaggatcgtcaggagatgcaacaacaagtggatgcatatggagaattatcaaaagatttctcaattgatcagttcactgatttcct |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4039015 |
aacgagccaatgatcacgatcgtcaggagatgcaacaacaagtggatgcatatggagaagtatcaaaagatttctcaattgatcaattcactgatttcct |
4039114 |
T |
 |
| Q |
101 |
taatgaccatgaggattatagcacaagcaacaatgaattgatcaatgacactgcacaattcgattacatttcgagtagttttgaatcgtgtttaaccgaa |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039115 |
caatgatcatgaggattatagcacaagcaacaatgaattgatcaatgacactgcacaattcgattacatttcgagtagttttgaatcgtgtttaaccgaa |
4039214 |
T |
 |
| Q |
201 |
aacaatggctgcaaggaggatgaaatgaatatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4039215 |
aacaatggctgcaaggaggatgaaatgaatatg |
4039247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University