View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16267_high_11 (Length: 291)
Name: NF16267_high_11
Description: NF16267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16267_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 274
Target Start/End: Complemental strand, 11150694 - 11150426
Alignment:
| Q |
8 |
agataatactgattttctttgactgatactcacatttgcttagccggggtcccttctcttttcgtatgtgaggtatgctctctatcaagatcttcttttc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11150694 |
agataacactgattttctttgactgatactcacatttgcttagccggggtcccttctcttttcgtatgtgagctatgctctctatcaagatcttcttttc |
11150595 |
T |
 |
| Q |
108 |
ttctctcacacttttatattctccatatttgctcagatttatcctccagctggtatttgctatgaggattatatgtaatgttatattatgttttagtaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11150594 |
ttctctcacacttttatattctccatatttgctcagatttatcctccagctggtatttgctatgaggattatatgtaatgttatattatgttttagtaat |
11150495 |
T |
 |
| Q |
208 |
gtgagggatat--atatttgaaactaagtgaataatatcatataaagagataaagacgaatttgattac |
274 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11150494 |
gtgagggatatatatatttgaaactaagtgaataatatcatataaagagataaagacgaatttgattac |
11150426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University