View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16267_high_17 (Length: 231)
Name: NF16267_high_17
Description: NF16267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16267_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 24 - 216
Target Start/End: Complemental strand, 15303887 - 15303696
Alignment:
| Q |
24 |
atcaaacacgccgatttctctgaatgcttatacggtttaggggtacgtatatatatcacttctggttatatgcttcaattgttgcattcttttccttttg |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15303887 |
atcaaacacaccgatttctctgaatgcttatacgatttaggggtacgtatatatatcacttctggttatatgcttcaattgttgcattcttttccttttg |
15303788 |
T |
|
| Q |
124 |
aacgaacactgttactgttattttctttgtttttcttgttttagatgtgtgctaaagaactcataattcctagtgatacccctgatccctatg |
216 |
Q |
| |
|
||| || ||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15303787 |
aactaa-actaacactgttattttctttgtttttcttgtcttagatgtgtgctaaagaactcataattcctagtgatacccctgatccctatg |
15303696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University