View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16267_high_19 (Length: 220)
Name: NF16267_high_19
Description: NF16267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16267_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 4756638 - 4756821
Alignment:
| Q |
16 |
cagagacatgtcgtaaggttctaaccgacgaagagaatctcaaggttggataccctcattcaaccatggtccttacaggtaaaagatcattccatggaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4756638 |
cagagacatgtcgtaaggttctaaccgacgaagagaatctcaaggttggataccctcattcaaccatggtccttacaggtaaaagatcattccatggaat |
4756737 |
T |
 |
| Q |
116 |
ctcaaattctgaacacaaacgtttgagacgtttaatcacttctcccataaatggtgacgaagcattgtcaacttatattggtct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4756738 |
ctcaaattctgaacacaaacgtttgagacgtttaatcacttctcccataaatggtgacgaagcattgtcaacttatattagtct |
4756821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University