View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16267_low_15 (Length: 260)
Name: NF16267_low_15
Description: NF16267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16267_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 247
Target Start/End: Original strand, 37544246 - 37544470
Alignment:
| Q |
23 |
gtcctgaccgtcatcttcaccaccatttcaatttatgaaatctatacttgaggtgggttcttcatccaaatcccctcctatgcatgagtgtgattcggtt |
122 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37544246 |
gtcctgaccgtcatcttcaccgccatttcaatttatgaaatctatacttgaggtgggttcttcatccaaatcccctcctatgcatgagtgtgatttggtt |
37544345 |
T |
 |
| Q |
123 |
ttaaattagagattttgaataacaagcagtggttttcatgattcttgagtataatgggtagaggggagaggaacctgtcatatcatgcattcacttgcta |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37544346 |
ttaaattagagattttgaataacaaacagtggttttcatgattcttgagtataatgggtagaggggagaggaacctgtcatatcatgcactcacttgcta |
37544445 |
T |
 |
| Q |
223 |
attggttaaattagtgtgatgatgt |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37544446 |
attggttaaattagtgtgatgatgt |
37544470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University