View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16267_low_22 (Length: 213)
Name: NF16267_low_22
Description: NF16267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16267_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 2497029 - 2496833
Alignment:
| Q |
1 |
aagtaaagaagaaaagaaaagggaaatgggttacatccccaaaatgaaaaacctcaatgattttactgtgaaagctgtctcgtcctttcctttactgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2497029 |
aagtaaagaagaaaagaaaagggaaatgggttacatccccaaaatgaaaaacctcaatgattttactgtgaaagctgtctcgtcctttcctttactgcca |
2496930 |
T |
 |
| Q |
101 |
acttgacaaattaagagatgttacagtcaatggcctcagaattgcaggtcatactaatttcatgttaacaaatcacaccatgagtcaactcaatagt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2496929 |
acttgacaaattaagagatgttacagtcaatggcctcagaattgcaggtcatactaatttcatgttaacaaatcacaccatgagtcaactcaatagt |
2496833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University