View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16271_high_10 (Length: 267)
Name: NF16271_high_10
Description: NF16271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16271_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 15441283 - 15441050
Alignment:
| Q |
17 |
gaacaaatttattacctccagattggatcagaaataggttgtggatcagcaatagtaacagcagttgcacatcctttgctggaatcgacttcaccttttt |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15441283 |
gaacaaatttcttacctccagattggatcagaaataggttgtggatcagcaatagtaacagcagttgcacatcctttgctggaatcgacttcaccttttt |
15441184 |
T |
 |
| Q |
117 |
ctgaatcaattatctcaatatctgaatctgtagtctcattgtctgaatctgtcgactcactatcagagtcatttatgactactacatctgtttcgcagtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15441183 |
ctgaatcaattatctcaatatctgaatctgtagtctcattgtctgaatctgtcgactcactatcagagtcatttatgactactacatctgtttcgcagtc |
15441084 |
T |
 |
| Q |
217 |
ctcgcaaaaccaaataacctcatccgtaaaaatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15441083 |
ctcgcaaaaccaaataacctcatccgtaaaaatt |
15441050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 11788593 - 11788637
Alignment:
| Q |
18 |
aacaaatttattacctccagattggatcagaaataggttgtggat |
62 |
Q |
| |
|
||||||||| |||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
11788593 |
aacaaattttttacctccagattggagcagcaataggctgtggat |
11788637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University