View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16271_high_13 (Length: 203)
Name: NF16271_high_13
Description: NF16271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16271_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 7371397 - 7371566
Alignment:
| Q |
15 |
gagcagagagtgaaagcctcaagtccatactgacaggagcccctccaagtaagcttggaaggatggctttggtggatgctctggcacaacatattcaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7371397 |
gagcagagagtgaaagcctcaagtccatactgacaggagcccctccaagtaagcttggaaggatggctttggtggatgctctggcacaacagattcaaaa |
7371496 |
T |
 |
| Q |
115 |
tcgcatgaagctgcgggtgcctaacctataag-nnnnnnnggtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
7371497 |
tcgcatgaagctgcgggtgcctaacctataagttttttttgttggtgtccggggttcgaaccccggacct |
7371566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 141
Target Start/End: Original strand, 10436179 - 10436305
Alignment:
| Q |
15 |
gagcagagagtgaaagcctcaagtccatactgacaggagcccctccaagtaagcttggaaggatggctttggtggatgctctggcacaacatattcaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
10436179 |
gagcagagagtgaaagcctcaagtccatactgacaggagcccctccaagtaagcttggaaggatagctttggtggatgctctggcacagcagattcaaaa |
10436278 |
T |
 |
| Q |
115 |
tcgcatgaagctgcgggtgcctaacct |
141 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10436279 |
tcgcatgaagctgcgggtgcctaacct |
10436305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Complemental strand, 32139411 - 32139383
Alignment:
| Q |
155 |
gtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32139411 |
gtggtgtccggggttcgaaccccggacct |
32139383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 183
Target Start/End: Complemental strand, 46987158 - 46987129
Alignment:
| Q |
154 |
ggtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46987158 |
ggtggtgtccggggttcgaaccccggacct |
46987129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 183
Target Start/End: Original strand, 31958457 - 31958486
Alignment:
| Q |
154 |
ggtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31958457 |
ggtggtgtccggggttcgaaccccggacct |
31958486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 183
Target Start/End: Complemental strand, 21638185 - 21638156
Alignment:
| Q |
154 |
ggtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21638185 |
ggtggtgtccggggttcgaaccccggacct |
21638156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 183
Target Start/End: Original strand, 23730368 - 23730397
Alignment:
| Q |
154 |
ggtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23730368 |
ggtggtgtccggggttcgaaccccggacct |
23730397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Original strand, 51429203 - 51429231
Alignment:
| Q |
155 |
gtggtgtccggggttcgaaccccggacct |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51429203 |
gtggtgtccggggttcgaaccccggacct |
51429231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University