View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16271_low_12 (Length: 259)
Name: NF16271_low_12
Description: NF16271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16271_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 40172611 - 40172840
Alignment:
| Q |
17 |
tgatgaacaactct--tagtttggccaagaataaaagctggattacactatcattagacaaatgnnnnnnntctacaactcgacgtcaaggttccaaatt |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40172611 |
tgatgaacaactctattagtttggccaagaataaaagctggattacactatcattagacaaatgaaaaaaatctacaactcgacgtcaaggttccaaatt |
40172710 |
T |
 |
| Q |
115 |
aattttcatagttacggtcattaagaattgcattaacctcgtgttagcaatatatttacgataaggttggcttctataaaaccacttattggaaaatatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40172711 |
aattttcatagttacggtcattaagaattgcattaacctcgtgttggcaatatatttacgataaggttggcttctataaaaccacttataggaaaatatt |
40172810 |
T |
 |
| Q |
215 |
ttgctttgaggacacgagtgaggagggaag |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40172811 |
ttgctttgaggacacgagtgaggagggaag |
40172840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University