View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16271_low_13 (Length: 240)
Name: NF16271_low_13
Description: NF16271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16271_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 51408738 - 51408538
Alignment:
| Q |
19 |
ataaggaaaaaagcatcaattttctcttcaaagactcttaaacaatctctatatttaagaaaagccgagtcaacaacaccagtgccactaccacacccca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51408738 |
ataaggaaaaaagcatcaattttctcttcaaagactcttaaacaatctctatatttaagaaaagccgagtcaacaacaccagtgccactaccacacccca |
51408639 |
T |
 |
| Q |
119 |
caccaaaccagaatcgaagacagcaaaaacaggtgccaacttctagcaatatgagcacaaagttggagccaaaataggtgccaacaacaaaaacacaccc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
51408638 |
caccaaaccagaatcgaagacagcaaaaacaggtgccaacttctagcaaaatgagcacaaagttggagcaaaaacaggtgccaacaacaaaaacacaccc |
51408539 |
T |
 |
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
51408538 |
a |
51408538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 143
Target Start/End: Complemental strand, 51408484 - 51408444
Alignment:
| Q |
103 |
ccactaccacaccccacaccaaaccagaatcgaagacagca |
143 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51408484 |
ccactaccacaccccacaccaaaccagaaccgaagacagca |
51408444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University