View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16273_low_4 (Length: 232)
Name: NF16273_low_4
Description: NF16273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16273_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 17634805 - 17634637
Alignment:
| Q |
15 |
acagaagaggagggagcaatcgcaaaccctatttagtattaatgaatccacgtgaatacacaacaccgccgttttggaattaacaaacgtgatgagaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
17634805 |
acagaagaggagggagcaatcgcaaaccctatttagtattaatgaatccacgtgaatacacaacaccaccgtttgggaattaacaaacgtgatgagaaaa |
17634706 |
T |
 |
| Q |
115 |
taaataggtggattccaattgagtggcaacgtaaagtaaaaagaatcacagggaatttctttgaagaaa |
183 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17634705 |
taaattggtggattccaattgagtggcaacgtaaagtaaaaagaatcacagtgaatttctttgaagaaa |
17634637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 17634480 - 17634444
Alignment:
| Q |
180 |
gaaagcctttgacaacggtcttaaactgaccattagt |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17634480 |
gaaagcctttgacaacagtcttaaactgaccattagt |
17634444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University