View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16274_high_8 (Length: 222)
Name: NF16274_high_8
Description: NF16274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16274_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 15 - 142
Target Start/End: Complemental strand, 2782703 - 2782576
Alignment:
| Q |
15 |
atgaagagaggaagaaaaattacaggatatatatttatactagttggtagcattagtttgcactatttgaagaacaagaagaaactggtggtggagttgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782703 |
atgaagagaggaagaaaaattacaggaaatatatttatactagttggtagcattagtttgcactatttgaagaacaagaagaaactggtggtggagttgt |
2782604 |
T |
|
| Q |
115 |
agatttccatggaaccacttgattttct |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2782603 |
agatttccatggaaccacttgattttct |
2782576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University