View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16274_low_7 (Length: 311)
Name: NF16274_low_7
Description: NF16274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16274_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 97 - 307
Target Start/End: Complemental strand, 28817901 - 28817691
Alignment:
| Q |
97 |
gttgaaacatttagaaatacattttgtggaattatatgatcctttaagcaaatataacattcttgcaagaaactgaagtctaatcatgttacctgaattg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817901 |
gttgaaacatttagaaatacattttgtggaattatatgatcctttaagcaaatataacattcttgcaagaaactgaagtctaatcatgttacctgaattg |
28817802 |
T |
 |
| Q |
197 |
atgttttctgctgattgtctagcatgtcatacaaacagttttaaggatgtggtgataaatgtcgttgttcaagtgacacttcttggcactactttgaaat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817801 |
atgttttctgctgattgtctagcatgtcatacaaacagttttaaggatgtgctgataaatgtcattgttcaagtgacacttcttggcactactttgaaat |
28817702 |
T |
 |
| Q |
297 |
tcatctcactc |
307 |
Q |
| |
|
|||| |||||| |
|
|
| T |
28817701 |
tcatgtcactc |
28817691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 28817982 - 28817929
Alignment:
| Q |
1 |
atggaatattatcttcatatctctactggtaagtccaaattatatatgatataa |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817982 |
atggaatattatcttcatatctctactggtaagtccaaattatatatgatataa |
28817929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University