View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16275_high_27 (Length: 237)

Name: NF16275_high_27
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16275_high_27
NF16275_high_27
[»] chr1 (2 HSPs)
chr1 (1-69)||(49689848-49689916)
chr1 (185-221)||(49690032-49690068)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 49689848 - 49689916
Alignment:
1 atagactaatgattagaaattcacacttaaatgaataagtgggaaattcgagattgctaacttctcttc 69  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||    
49689848 atagactaatgattagaaatttacacttaaatgaataagtgggaaattcgagattgttaacttctcttc 49689916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 221
Target Start/End: Original strand, 49690032 - 49690068
Alignment:
185 tttccacaatcatatagctttagtagtagttataact 221  Q
    |||||||||||||||||||||||||||||||||||||    
49690032 tttccacaatcatatagctttagtagtagttataact 49690068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University