View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_20 (Length: 278)
Name: NF16275_low_20
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_20 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 14 - 278
Target Start/End: Original strand, 13128972 - 13129236
Alignment:
| Q |
14 |
atatgatagccagactcttgattttggtttacagcaaaacatgtcacgttaattcacaatctcactactataaatacttttagaatgtttgtaaatcaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13128972 |
atatgatagccagactcttgattttggtttacagcaaaacatgtcacgttaattcacaatctcactactataaatacttttagaatgtatgtaaatcaag |
13129071 |
T |
|
| Q |
114 |
gtaagatgtgcccctctattattccaatttcaaatggtcactgtgtttgctcattttgaatcacaaatgagaagtatagatccaaattatttcagcacct |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13129072 |
gtaagatttgcccctctattattccaatttcaaatggtcactatgtttgctcattttgaaccacaaatgagaagtatagatccaaattatttcagcacct |
13129171 |
T |
|
| Q |
214 |
gtgacttcttttctaatgtggaaaccaaacttgatcgaatcatatcagaccagactttgctcaaa |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13129172 |
gtgacttcttttctaatgtggaaaccaaacttgatcgaatcatatcagaccagactttgctcaaa |
13129236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 260
Target Start/End: Original strand, 40508417 - 40508483
Alignment:
| Q |
194 |
tccaaattatttcagcacctgtgacttcttttctaatgtggaaaccaaacttgatcgaatcatatca |
260 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||| || || ||||| ||||| |||||||||||||| |
|
|
| T |
40508417 |
tccaatttattgcagcacctgtgatttcttttccaaagtagaaactaaactgaatcgaatcatatca |
40508483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University