View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_29 (Length: 243)
Name: NF16275_low_29
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 4357835 - 4357641
Alignment:
| Q |
14 |
agagtccatctagtaacacgattgttcaatataagtcactcaaattactcaattgatcgggtcataacccacgctcgatgaatatttttcgtgagtaaaa |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
4357835 |
agagcccatctagtaacacgattgttcaatataagtcactcaaattactcaattgatcgggtcataacccaccctcgatgaatattttttgtgagtaaaa |
4357736 |
T |
|
| Q |
114 |
ctcgatcgcgactgtaacctttgaatggttatttttctgaaaatgtgagcaatttgaggggcttttaccatcatataatgcaaaccacattcata |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
4357735 |
ctcgatcgcggctgtaacctttgaatggttatttttctgaaaatgtgagcagtttgaggggctattaccatcatataatgcaaaccacactcata |
4357641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 177
Target Start/End: Complemental strand, 9984709 - 9984675
Alignment:
| Q |
143 |
tatttttctgaaaatgtgagcaatttgaggggctt |
177 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9984709 |
tatttttctgaaattgtgagcaatttgaggggctt |
9984675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University