View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_30 (Length: 237)
Name: NF16275_low_30
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 49689848 - 49689916
Alignment:
| Q |
1 |
atagactaatgattagaaattcacacttaaatgaataagtgggaaattcgagattgctaacttctcttc |
69 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49689848 |
atagactaatgattagaaatttacacttaaatgaataagtgggaaattcgagattgttaacttctcttc |
49689916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 221
Target Start/End: Original strand, 49690032 - 49690068
Alignment:
| Q |
185 |
tttccacaatcatatagctttagtagtagttataact |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49690032 |
tttccacaatcatatagctttagtagtagttataact |
49690068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University