View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_32 (Length: 234)
Name: NF16275_low_32
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 4163058 - 4162849
Alignment:
| Q |
1 |
ttaatttcttaagttattctcattttgatccttaagttactgacgttagacacactttgacgctttgtgttggttttttgtttatgttagccaaaaaatt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4163058 |
ttaatttcttaagttgttctcattttgatccttaagttactgacattagacacactttgacgctttgtgttggttttttgtttatgttagccaaaaattt |
4162959 |
T |
|
| Q |
101 |
tctatattttcttcttgttgttgagtcaggtgcatctaatcataatgctatgtatgtaggaaagatttccatagtcaaataaaaaattgattgaaagaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
4162958 |
tctatattttcttcttgttgttgagtcgggtgcatctaatcataatgctatgtatgtaggaaagatttccatagtcaaatgaaaaattgattgaaagtac |
4162859 |
T |
|
| Q |
201 |
caaaatgtct |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
4162858 |
caaaatgtct |
4162849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University