View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16275_low_34 (Length: 225)

Name: NF16275_low_34
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16275_low_34
NF16275_low_34
[»] chr4 (2 HSPs)
chr4 (1-140)||(4163189-4163328)
chr4 (161-225)||(4163135-4163199)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 4163328 - 4163189
Alignment:
1 ttactatagtgattggtaattttggagaacccannnnnnnncttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataattttttggaatt 100  Q
    ||||||||||||| |||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4163328 ttactatagtgatcggtaattttggagaacccattttttttcttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataattttttggaatt 4163229  T
101 cagtcttttatatgcaagtaaggggaacatgttgtgcata 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
4163228 cagtcttttatatgcaagtaaggggaacatgttgtgcata 4163189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 161 - 225
Target Start/End: Complemental strand, 4163199 - 4163135
Alignment:
161 tgttgtgcataccctatagcttttttattaattataaatcgtaaattacaatttcggtccctaaa 225  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
4163199 tgttgtgcatatcctatagcttttttattaattataaatcgtaaattacaattttggtccctaaa 4163135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University