View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_34 (Length: 225)
Name: NF16275_low_34
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 4163328 - 4163189
Alignment:
| Q |
1 |
ttactatagtgattggtaattttggagaacccannnnnnnncttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataattttttggaatt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163328 |
ttactatagtgatcggtaattttggagaacccattttttttcttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataattttttggaatt |
4163229 |
T |
 |
| Q |
101 |
cagtcttttatatgcaagtaaggggaacatgttgtgcata |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163228 |
cagtcttttatatgcaagtaaggggaacatgttgtgcata |
4163189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 161 - 225
Target Start/End: Complemental strand, 4163199 - 4163135
Alignment:
| Q |
161 |
tgttgtgcataccctatagcttttttattaattataaatcgtaaattacaatttcggtccctaaa |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4163199 |
tgttgtgcatatcctatagcttttttattaattataaatcgtaaattacaattttggtccctaaa |
4163135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University