View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_38 (Length: 205)
Name: NF16275_low_38
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 43278891 - 43279062
Alignment:
| Q |
16 |
attatactgttatatatgtgtttagagacataggatggaaagttgggagatagtggtgtgtgaactgtttttacgggttaatgtatcaggggaagttgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43278891 |
attatactgttatatatgtgtttagagacataggatggaaagttgggagatagtggtgtgtgaactgtttttacgggttaatgtatcaggggaagttgtg |
43278990 |
T |
 |
| Q |
116 |
aaggattgattggcatcaattgaatttggaactagtgaaaaggtcatttacgagggagagaaaaggtcactat |
188 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43278991 |
aaggattgatcggcatc-attgaatttggaaccagtgaaaaggtcatttacgagggagagaaaaggtcactat |
43279062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University