View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16275_low_39 (Length: 201)
Name: NF16275_low_39
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16275_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 44605988 - 44606159
Alignment:
| Q |
16 |
acttctttcgccgatcgatatgaggatagttagatccaatagttggactactggatgtctcctcagattcattacttctaatagaacttgttgttagaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605988 |
acttctttcgccgatcgatatgaggatagttagatccaatagttggattactggatgtctcctcagattcattacttctaatagaacttgttgttagaat |
44606087 |
T |
 |
| Q |
116 |
ttcatatgtatcgaagaatgcgtcattctcatcttcagagttatcatcatttctatcttgctcatcagaata |
187 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606088 |
ttcatatgtatcgaagaatgcatcattctcatcttcggagttatcatcatttctatcttgctcatcagaata |
44606159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University