View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16276_high_8 (Length: 329)
Name: NF16276_high_8
Description: NF16276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16276_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 26753117 - 26752800
Alignment:
| Q |
1 |
attaactctcagccaattattccctccgtcattatctgaatatatacttttgccttcaacttcaactccccctttttccaccctcaaagtgtaaaatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26753117 |
attaactctcagccaattattccctccgtcattatctgaatatatacttttgccttcaacttcaactccccctttttccaccctcaaagtgtaaaatttc |
26753018 |
T |
 |
| Q |
101 |
cattacttgacgcaaagggacacatgaaatatgtctcatgtatgtaataacgtaacgaccaaacacaatcaagtacttcaatgtgtatggtgttaatcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26753017 |
cattacttgacgcaaagggacacatgaaatatgtctca--tatgtaataacgtaacgaccaaacacaatcaaatacttcaatgtgtatggtgttaatcat |
26752920 |
T |
 |
| Q |
201 |
aggagtattttgttcatttattggtttgtgcacttatcccaaccatatatatataaatcaaagggnnnnnnngatagatagatgggtcatgtctttttca |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26752919 |
aggagtactttgttcatttattggtttgtgcacttatcccaaccatgtatatataaatcaaagggaaaaaaagatagatagatgggtcatgtctttttca |
26752820 |
T |
 |
| Q |
301 |
ggtatcttaccaagaataat |
320 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
26752819 |
ggtatcttacccagaataat |
26752800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University