View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16277_high_2 (Length: 244)
Name: NF16277_high_2
Description: NF16277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16277_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 51 - 229
Target Start/End: Complemental strand, 2785593 - 2785415
Alignment:
| Q |
51 |
actttaaaacaagcacaccctaaacattatcttttctcaacgtgaggacgttgatttaatggctcaggcgtttatggttaattgttttcatatcaaatcc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2785593 |
actttaaaacaagcacaccctaaacattatcttttctcaacgtgaggacgttgatttaatgtctcaggtgtttatggttaattgttttcatatcaaatcc |
2785494 |
T |
 |
| Q |
151 |
tctttatcttttgtaattccacaccnnnnnnncgttgataaaagtaaatccactcttttgtcatgtttccttcatctct |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2785493 |
tctttatcttttgtaattccacacctttttttggttgataaaagtaaatccactcttttgtcatgtttccttcatctct |
2785415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University