View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16278_low_5 (Length: 250)
Name: NF16278_low_5
Description: NF16278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16278_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35491337 - 35491427
Alignment:
| Q |
1 |
ttagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttatagtaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35491337 |
ttagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttataataatg |
35491427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 2 - 85
Target Start/End: Original strand, 35497570 - 35497652
Alignment:
| Q |
2 |
tagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttata |
85 |
Q |
| |
|
|||||| |||| |||| ||||||| || |||||||||||||||||||||||||| ||||||||||| |||| | || ||||||| |
|
|
| T |
35497570 |
tagtgtctactaatgccatgcaat-tactattggcaattatatgatgaagattttactaattttttatttttcctatgcttata |
35497652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University