View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_high_23 (Length: 443)
Name: NF1627_high_23
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 3e-55; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 318 - 427
Target Start/End: Complemental strand, 52710847 - 52710738
Alignment:
| Q |
318 |
aagaaaattgctttaataggtttttaaggaataaaccccatcattttaaagacaactgctataaaccaatcgtttaagaaattataatatgaatgtatca |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710847 |
aagaaaattgctttaataggtttttaaggaataaaccccatcattttaaagacaactgctataaaccaatcgtttaagaaattataatatgaatgtatca |
52710748 |
T |
 |
| Q |
418 |
atatcactat |
427 |
Q |
| |
|
|||||||||| |
|
|
| T |
52710747 |
atatcactat |
52710738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 162 - 256
Target Start/End: Complemental strand, 52710990 - 52710907
Alignment:
| Q |
162 |
ttattgtgaatattatagtcaaatgcataataatttaggtacaatattaaaaaagtatttaaaaatttatttcaagagccaaaagatgaagctaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710990 |
ttattgtgaatattatagtcaaatgcataataatttaggtacaa-----------tatttaaaaatttatttcaagagccaaaagatgaagctaa |
52710907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 52711089 - 52711034
Alignment:
| Q |
1 |
actaaacatttttgtatttatagtatggagccttctattgtccgtctcaaaaataa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711089 |
actaaacatttttgtatttatagtatggagccttctattgtccgtctcaaaaataa |
52711034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University