View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_high_26 (Length: 431)
Name: NF1627_high_26
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_high_26 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold1694 (1 HSPs) |
 |  |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0040 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
| [»] scaffold0674 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0081 (1 HSPs) |
 |  |  |
|
| [»] scaffold0567 (1 HSPs) |
 |  |  |
|
| [»] scaffold0524 (1 HSPs) |
 |  |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0549 (1 HSPs) |
 |  |  |
|
| [»] scaffold0318 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0087 (1 HSPs) |
 |  |  |
|
| [»] scaffold0059 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (2 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 321; Significance: 0; HSPs: 111)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 14 - 428
Target Start/End: Original strand, 16204683 - 16205101
Alignment:
| Q |
14 |
atttgttcatactaagttgatagaactctttctacaatgcaattaatttgctacttagaatgtgtgtggacatcactaatttgaagnnnnnnnattggtg |
113 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16204683 |
atttgtccatactaagttaatagaactctttctacaatgcaattaatttgctactttgaatgtgtgtggacatcactaatttgaagtttttttattggtg |
16204782 |
T |
 |
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaagtg----acaacatatatagcatataaaattgaaaa |
209 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
16204783 |
gtggtcgggatttgaaccccggaccttgcatacattatgcattgtccatatcaaccgagctaaactttataacaagctatatagcatataaaattgaaaa |
16204882 |
T |
 |
| Q |
210 |
taaataaaatagttctagttaattaattacctgccccagttggatcagtgactttggtttgataattggctggagcatgtgcatcaaatctacttcctgg |
309 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16204883 |
taaatgaaatagttctagttaattaattacctgccccagttggatcagtgactttggtttgataattggctggagcatgtgcatcaaatctacttcctgg |
16204982 |
T |
 |
| Q |
310 |
tgcatgaggatcttcaaccaaatcaaccttaggttgcacaattgttatctcttccctaacaattgttgttctagctggtttaacaactaatactcttggc |
409 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16204983 |
tgcatgaggatcttccaccaaatcaaccttaggttgcacaattgttatctcttccctaacaattgttgttctagttggtttaacaactaatactcttggc |
16205082 |
T |
 |
| Q |
410 |
tcatgatgatgtccatctc |
428 |
Q |
| |
|
||||||| |||||| |||| |
|
|
| T |
16205083 |
tcatgatcatgtccttctc |
16205101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 24623307 - 24623373
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24623307 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtccatatcaactgagctaaa |
24623373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 20744206 - 20744144
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
20744144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 4455586 - 4455651
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
4455586 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgccttgtccataccaactgagctaa |
4455651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 13496190 - 13496126
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
13496190 |
ttggtgttggtcggggtttgaactccggaccttgcatatattatgcattgttcatatcaactgag |
13496126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 33824951 - 33824887
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagctaa |
33824887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 108 - 175
Target Start/End: Original strand, 26489935 - 26490002
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
26489935 |
ttggtggtggttggggtttgaaccctggactttgcatattttatacattgtccctatcaactgagcta |
26490002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 8569780 - 8569714
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||||||||||||| ||| |||| |||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaattgagttaaa |
8569714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 15187134 - 15187069
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| | ||||| ||||||||| |
|
|
| T |
15187134 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcattgtacttatcagctgagctaa |
15187069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 15473472 - 15473537
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| | ||||| ||||||||| |
|
|
| T |
15473472 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcattgtacttatcagctgagctaa |
15473537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 17935800 - 17935735
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
17935800 |
gtggtggtcgggatttgaaccctagaccttgcatattttatgcattgtccaaaccaactgagctaa |
17935735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 29740553 - 29740488
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| || ||||||||||||||||| ||| |||||||| |
|
|
| T |
29740553 |
gtggtggccggggtttgaaccccggaccttgcgtatattatgcattgtccataccaattgagctaa |
29740488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 655736 - 655804
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| ||||||| |||||| |||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
655736 |
ttggtagtggccggggttcgaaccccggaccttgcatatattatgcattgtcgataccaactgagctaa |
655804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 14918293 - 14918355
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
14918293 |
gtggtcggggtttgaaccccagaccttgtatatattatgcattgtccctaccaactgagctaa |
14918355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 24827120 - 24827058
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
24827120 |
gtggtcggggttcgaaccctgaaccttatatattttatgcattgtccatatcaactgagctaa |
24827058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 173
Target Start/End: Original strand, 28231415 - 28231477
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||||| ||| || ||||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
28231415 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagc |
28231477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 788937 - 788876
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| |||||||||||||| || |||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtccttaccaactgag |
788876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 2726415 - 2726468
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
2726415 |
cggggttcgaaccccggaccttgcatatattatgcattgtccataccaactgag |
2726468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 8629686 - 8629747
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
8629686 |
gtggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaattgag |
8629747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 115 - 176
Target Start/End: Original strand, 12333562 - 12333623
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
12333562 |
tggtcggggtttaaactctggaccttgcatattttatgcattgtccatactaactgagctaa |
12333623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 2445373 - 2445309
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||| |||||| | | |||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
2445373 |
ttggtggtggtcggggttcgaaccccgaatcttgtatatattatgcattgttcatatcaactgag |
2445309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 12700408 - 12700476
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||| |||||||||||| |||| ||||||| |||| |
|
|
| T |
12700408 |
ttggtggtggccggggttcaaaccctagaccttgcatatattatgcattgttcataccaactgaactaa |
12700476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 14610054 - 14609987
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
14610054 |
ttggtggtggccggggtttgaaccc-ggaccttacatatattatagattgtccctatcaactgagctaa |
14609987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 18256940 - 18256889
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18256940 |
tttgaaccc-ggaccttgcatatattatgcattgtccttatcaactgagctaa |
18256889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 22792927 - 22792995
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| ||||| | |||||| || |||||||||||| |
|
|
| T |
22792927 |
ttggtcgtggtcggggtttgaaccccggaccttacatatattattcgttgtccttaccaactgagctaa |
22792995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 27907938 - 27908006
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||| ||| | ||||||||||||| |
|
|
| T |
27907938 |
ttggtggtggccggggtttgaaccccagaccttgcatattttatgcattatccttgtcaactgagctaa |
27908006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 32053858 - 32053794
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
32053858 |
tggtggccggagtttgaaccacgaaccttgcatatattatgcattgtccataccaactgagctaa |
32053794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 160
Target Start/End: Original strand, 32524411 - 32524459
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32524411 |
tggtggttggggtttgaaccctggactttgcatatattatgcattgtcc |
32524459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 34481401 - 34481465
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| || ||||||||| |||| ||||||| |
|
|
| T |
34481401 |
ttggttgtggtcggggtttgaaccccggaccttgcatatataatgcattgttcatactaactgag |
34481465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 14441455 - 14441510
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || | ||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
14441455 |
gggtttgaagcccgaaccttgcatacattatgcattgtccttaccaactgagctaa |
14441510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 158
Target Start/End: Original strand, 18253329 - 18253376
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18253329 |
gtggtggatggggtttgaaccctggaccttgcatatattatgcattgt |
18253376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 115 - 177
Target Start/End: Original strand, 866279 - 866341
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||| || | || ||||||||||||| |
|
|
| T |
866279 |
tggtcggggtttgaaccatgaaccttgcatatattatgcatcgtgcctaccaactgagctaaa |
866341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 8138448 - 8138514
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| | ||||||||||| |||||| |||| |||||||||||| | |||||||||||||||| |
|
|
| T |
8138448 |
gtggtggttgaggtttgaaccccagaccttacatatattatgcattgttcttatcaactgagctaaa |
8138514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 9111111 - 9111053
Alignment:
| Q |
118 |
tcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||| |||||||||||| |||||||||||| |||| ||||||| |||| |
|
|
| T |
9111111 |
tcggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgaactaa |
9111053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 158
Target Start/End: Original strand, 12323477 - 12323527
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
12323477 |
ttggtggtggtcggtgtttgaaccctgaaccttgtatatattatgcattgt |
12323527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 15170002 - 15169936
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| |||||||||||| | || || |||||||||| |
|
|
| T |
15170002 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtacttaccagctgagctaaa |
15169936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 15178774 - 15178708
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| |||||||||||| | || || |||||||||| |
|
|
| T |
15178774 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtacttaccagctgagctaaa |
15178708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 30960054 - 30960108
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||||||||||||||||| |||| ||||||||| || |||||||||||| |
|
|
| T |
30960054 |
ggttcgaaccctggaccttgcatatattaagcattgtccttaccaactgagctaa |
30960108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 4450317 - 4450268
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
4450317 |
gaaccccggaccttgcatatattatgcattgtctttatcaactgagctaa |
4450268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 9445028 - 9444963
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||| |||| |||||| |||| |||||||||||| |
|
|
| T |
9445028 |
gtggtggtcgggattcgaaccctgaaccttgcatattttatacattgttcataccaactgagctaa |
9444963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 9977128 - 9977067
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||||||| |||||| ||| |||| |
|
|
| T |
9977128 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcattatccataccaattgag |
9977067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 12232172 - 12232233
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
12232172 |
gtggtggtcggggttcgaaccccagacactgcatatattatgcattgtccctatcaactgag |
12232233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 14296947 - 14297012
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| ||||||| |||| ||||| |||||||||| ||||| |||||| |
|
|
| T |
14296947 |
gtggtggccggggtttgaaccccggaccttacatattttatgtattgtccataccaactcagctaa |
14297012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 15155806 - 15155741
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||||| | || || ||||||||| |
|
|
| T |
15155806 |
gtggtggtcgtggtttgaaccccagaccttgcatatattatgcattgtacttaccagctgagctaa |
15155741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 26320566 - 26320618
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
26320566 |
gtttgaaccc-ggaccttgcatattttatgcattgtccataccaactgagctaa |
26320618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 29283886 - 29283825
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||| ||||| ||||||| || |||||||| |
|
|
| T |
29283886 |
gtggtggtcggagtttgaaccctagaccttgcatatattatacattgtctctaccaactgag |
29283825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 2546254 - 2546210
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatg |
152 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
2546254 |
ttggtggtggtcggggtttgaaccccgtaccttgcatatattatg |
2546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 2613563 - 2613499
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||| |||||||| ||||| | ||||||||||| |||| |||||||||| | ||||||||||| |
|
|
| T |
2613563 |
gtggtgatcggggttcgaaccttagaccttgcatatattaagcattgtccaaaccaactgagcta |
2613499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 8639105 - 8639053
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||| |||||| ||||||||||| |
|
|
| T |
8639105 |
gtttgaaccccggaccttgcatatactatgcattatccataccaactgagcta |
8639053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 9392659 - 9392723
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||| |||||||||| | |||| |||||||||||| |
|
|
| T |
9392659 |
tggtagtcggggtttaaacctcggaccttgcatatattatgcatttttcataacaactgagctaa |
9392723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 12318825 - 12318773
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| |||| ||||||| |||| |
|
|
| T |
12318825 |
tttgaaccctagaccttgcatacattatgtattgttcatagcaactgaactaa |
12318773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 13376386 - 13376318
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||| ||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
13376386 |
ttggtggtggccagggttagaaccccggaccatgcatgtattatgcattgtccataccaattgagctaa |
13376318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 16390499 - 16390439
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| || ||||||||||| ||||||| |||| |||||||||||||| || |||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctaccaactgag |
16390439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 20847499 - 20847566
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
20847499 |
ttggtggtggttgaggtttgaaccc-ggaccttgcatattttatgcattgtccaaactaactgagctaa |
20847566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 21847268 - 21847200
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| || |||||| | |||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
21847268 |
ttggtggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctaccaactgagctaa |
21847200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 26400934 - 26400870
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| ||||| |||||||||||| |||||| |||||||||| ||| |||||||| |
|
|
| T |
26400934 |
tggtggccggggttcaaaccccggaccttgcatatattatgtattgtccataccaattgagctaa |
26400870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 28758277 - 28758345
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||| |||||||||||| | || || ||||||||| |
|
|
| T |
28758277 |
ttggtggtgttcggggtttgaacctcggactttgcatatattatgcattgttcttaccagctgagctaa |
28758345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Complemental strand, 291429 - 291378
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
291429 |
ggggtttgaaccccggaccttgcatatattatgcatgatccataccaactga |
291378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 2692276 - 2692225
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
2692276 |
gggtttgaatctcggatcttgcatatattatgcattgtccatatcaactgag |
2692225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 138 - 177
Target Start/End: Original strand, 3373398 - 3373437
Alignment:
| Q |
138 |
cttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
3373398 |
cttgcatatattatgcattgtccatatcaactgagttaaa |
3373437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 8637437 - 8637492
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcattgtccctaccaactgaactaa |
8637492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 8831264 - 8831217
Alignment:
| Q |
125 |
ttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
8831264 |
ttgaaccccggaccttgcataaattatgcattgtccttaccaactgag |
8831217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 8834987 - 8834940
Alignment:
| Q |
125 |
ttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8834987 |
ttgaaccccggactttgcatacattatgcattatccttatcaactgag |
8834940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 11456366 - 11456424
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactg |
170 |
Q |
| |
|
||||||| |||||||||||||| | ||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
11456366 |
gtggtggccggggtttgaaccccg-accttacatatattatgcattgtccataccaactg |
11456424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 136 - 175
Target Start/End: Complemental strand, 12204415 - 12204376
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
12204415 |
accttacatatattatgcattgtccatatcaactgagcta |
12204376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 122 - 177
Target Start/End: Original strand, 16458285 - 16458340
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| | || ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
16458285 |
ggtttgaaacttgaaccttgcatgtattatgcactgtccatatcaactgagctaaa |
16458340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 18254097 - 18254156
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||| || ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
18254097 |
gtcggggttcgaatcccggaccttgcatgtattatgcattgtccttaccaactgagctaa |
18254156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 20720789 - 20720836
Alignment:
| Q |
129 |
accctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20720789 |
accccggaccttacatatattatgcattgtccataacaactgagctaa |
20720836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 31971590 - 31971539
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
31971590 |
gggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgag |
31971539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 171
Target Start/End: Complemental strand, 34474297 - 34474238
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||| |||||||||||| || |||| |||| |
|
|
| T |
34474297 |
tggtggccggggttcgaaccatggaccttgcatatattatgcattgttcaaatcagctga |
34474238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 172
Target Start/End: Original strand, 1794964 - 1795002
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
1794964 |
ggaccttacatatattatgcattgtccatatcaactgag |
1795002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 5267095 - 5267033
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||| ||||||| ||| ||||||||||| |
|
|
| T |
5267095 |
gtggtggtcggggtttgaattccggaccttgcatatattaatgcattatccttatcaactgag |
5267033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 6018646 - 6018716
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||| ||| || ||||||| ||||||||||||||||| |
|
|
| T |
6018646 |
ttggtggtgtccggggttcgaacccacgaccttgcatatatttatacattgtctatatcaactgagctaaa |
6018716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 161
Target Start/End: Complemental strand, 9367472 - 9367422
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
161 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
9367472 |
gtggtggtcggggtttgaatcccagaccttgcatattttatgcattgtcca |
9367422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 11012245 - 11012188
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgc--attgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
11012245 |
gggttcgaaccctggaccttgcatattttatgcatattgtccataccaactgagctaa |
11012188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 19988893 - 19988827
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
19988893 |
gtggtgttcggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaa |
19988827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 131 - 177
Target Start/End: Original strand, 21373416 - 21373462
Alignment:
| Q |
131 |
cctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
21373416 |
cctggaccttgcatattttatgcattgtccataccaattgagctaaa |
21373462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 29069551 - 29069489
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||||||||||| ||| || |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29069551 |
gtggccggggtttgaacctcagacttttcatatattatgcattgtccctatcaactgagctaa |
29069489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 29680659 - 29680593
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||| | | |||||||||| |||||||||| ||| |||||| | ||||||| |
|
|
| T |
29680659 |
gtggtggtcggagtttgaacaccgaaccttgcatatattatgcattatccctatcaaataagctaaa |
29680593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 247730 - 247681
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
247730 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
247681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 334187 - 334146
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
334187 |
gaccttgcatatattatgcattgtctttatcaactgagctaa |
334146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 169
Target Start/End: Complemental strand, 3242566 - 3242509
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||| |||||| | ||||||||||||| ||||| |||||| |||| ||||| |
|
|
| T |
3242566 |
tggtggtcgggatttgaatcatggaccttgcatatattatccattgtgcataccaact |
3242509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 161
Target Start/End: Complemental strand, 4257675 - 4257622
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
161 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
4257675 |
ttggtggtggccggggtttgaaccccagaccttgcataagatatgcattgtcca |
4257622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 7081644 - 7081709
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||| |||| | ||||||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
7081644 |
gtggtggtttgggtttcaaccttagaccttgcatatattatgtattgtctttatcaactgagctaa |
7081709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 8393739 - 8393792
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
161 |
Q |
| |
|
||||| |||| ||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
8393739 |
ttggtagtggccggggtttgaaacctggaccttgcatattttatgcattatcca |
8393792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 12904319 - 12904368
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| | | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
12904319 |
gtttgaactccgaaccttgcatatattatgcattgttcatatcaactgag |
12904368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 13554447 - 13554382
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| || |||| || |||||| |||||||| | |||||||||||| |
|
|
| T |
13554447 |
gtggtggtcggggtttgaaccccagatcttggatgtattatggattgtccagaccaactgagctaa |
13554382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 163
Target Start/End: Complemental strand, 17145533 - 17145500
Alignment:
| Q |
130 |
ccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
17145533 |
ccctggaccttgcatatattatgcattgtccata |
17145500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 27080688 - 27080753
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| || || |||||||| ||||||||||||| || ||||||| |||| |
|
|
| T |
27080688 |
gtggtggtcggggtttgaatcccagagcttgcatatattatgcattgtctctaacaactgaactaa |
27080753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 27834410 - 27834361
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
27834410 |
gtggtggtccgggtttgaaccccagaccttgcatatattatgccttgtcc |
27834361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 171
Target Start/End: Complemental strand, 28318075 - 28318038
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
28318075 |
ggaccttgcatatattatgcattgtccataccaactga |
28318038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 28951470 - 28951409
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| || ||||| ||| ||| |||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
28951470 |
gtggtggccgaggtttaaactctgaaccttgcatatattatgcattgttcataccaactgag |
28951409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 160
Target Start/End: Complemental strand, 33976307 - 33976266
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
33976307 |
cggggtttgaaccccggaccttgcatattttatgcattgtcc |
33976266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 4855627 - 4855575
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||||||||||| |||| | ||| |||| |||||||||||||||| |
|
|
| T |
4855627 |
gtggtggtcggggtttgaatcctgaatcttacatattttatgcattgtccata |
4855575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 7082979 - 7083047
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| | || |||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
7082979 |
ttggtggtggctggggtttgaactccagatcttgcatatattatgcattgtccttaccaattgagctaa |
7083047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 8381193 - 8381245
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
8381193 |
ggggttcgaaccctggaccttgcatatgttatgcattgtctttaccaactgag |
8381245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 8840510 - 8840558
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||| |||||||||||||| || || |||| ||||||||||||| |
|
|
| T |
8840510 |
gtggtggtccgggtttgaaccctgtactttacatatattatgcattgtc |
8840558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 9333805 - 9333737
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || | ||| ||||| |||||||||||| || ||||||||||| || ||| |||||||| |
|
|
| T |
9333805 |
ttggtggtggccgagatttaaaccccggaccttgcatatataatgcattgtccttaccaattgagctaa |
9333737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 9372343 - 9372410
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| || |||||||||||||| | || ||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
9372343 |
ttggtgggggccggggtttgaaccccgaac-ttgcatatattatgcgttgtccatactaactgagctaa |
9372410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 10053320 - 10053256
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| | |||||||| | | || || |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10053320 |
tggtggtctgagtttgaactccgaactttacatatattatgcattgtccataccaactgagctaa |
10053256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 10278527 - 10278463
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||| |||| || |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
10278527 |
ttggtggtggttggggttcgaacttcagatcttgcatatattatgcattgtccatatcaattgag |
10278463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 14917778 - 14917830
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||| |||||| || |||| || |||||||||||| |
|
|
| T |
14917778 |
tttgaaccctggtccttgcatatattatgtatcgtccctaccaactgagctaa |
14917830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 14945504 - 14945568
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||| || | ||||| |||| |||||||| |||| ||||||||||||||| |
|
|
| T |
14945504 |
tggtggttggggtttgaatcccgaaccttacatatattatgcactgtctctatcaactgagctaa |
14945568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 17151310 - 17151242
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||||||| |||||| |||||| || ||||| |||||| |
|
|
| T |
17151310 |
ttggtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtcactaccaacttagctaa |
17151242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 24248239 - 24248171
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| || |||||||| ||||||| |||| |||||| ||| ||| || |||||| ||||| |
|
|
| T |
24248239 |
ttggtggtggtcgagggttgaaccccggaccttacatatattatgtattatccttaccaactgtgctaa |
24248171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 24373700 - 24373748
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24373700 |
gtggtggctggggtttgaacccctgaccttgcatatattatgcattgtc |
24373748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 114 - 174
Target Start/End: Original strand, 26356074 - 26356134
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||| ||| |||||||||| | |||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcattgtcccaaccaactgagct |
26356134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 169
Target Start/End: Complemental strand, 28898925 - 28898869
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||| |||||||||||| | ||||||| |||| |||||||||||||| || ||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgtccttaccaact |
28898869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 32621443 - 32621399
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||| ||||||||| |
|
|
| T |
32621443 |
gtggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 160
Target Start/End: Original strand, 33542798 - 33542846
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| |||||||| || |||||||||| |||||||||||||| |
|
|
| T |
33542798 |
tggtggtcggagtttgaactatgaaccttgcatatattatgcattgtcc |
33542846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 33938694 - 33938734
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
33938694 |
accttgcatatattatgcattgttcataccaactgagctaa |
33938734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 2e-22; HSPs: 168)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 8781643 - 8781705
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcattgtccataccaactgagctaa |
8781705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 25186232 - 25186298
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25186232 |
gtggtggctggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagctaaa |
25186298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 29734758 - 29734696
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcatatattatgcattgtccatatcaactgagctaaa |
29734696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 112 - 169
Target Start/End: Original strand, 660813 - 660870
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtccataccaact |
660870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 109 - 172
Target Start/End: Original strand, 9547397 - 9547460
Alignment:
| Q |
109 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9547397 |
tggtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtccatatcaactgag |
9547460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 20565065 - 20565130
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
20565065 |
gtggtggttggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
20565130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 23250310 - 23250371
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| | || |||||||| |
|
|
| T |
23250310 |
gtggtggtcggggtttgaaccctggaccttgcatatattatgcattgttcttaccaactgag |
23250371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 27244724 - 27244663
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
27244724 |
tggtcgggctttgaaccctagaccttgcatatattatgcattgtccctatcaactgagctaa |
27244663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 31815877 - 31815938
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgag |
31815938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 10735818 - 10735886
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||| |||| || |||||||||||| |
|
|
| T |
10735818 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaa |
10735886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 24592833 - 24592901
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
24592833 |
ttggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
24592901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 27411166 - 27411098
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
27411166 |
ttggtggtggccggggttcgaaccccggaccttgcatatattatgcaaggtccatatcaactgagctaa |
27411098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 29544701 - 29544633
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
29544701 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctaccaattgagctaa |
29544633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 33064060 - 33063992
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||| ||| |||| | |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33064060 |
ttggtggtggccggagttcgaactccggaccttgcatatattatgcattgtccatatcaactgagctaa |
33063992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 25598562 - 25598617
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
25598562 |
gggttcgaaccctggaccttgcatatattatgcattgtccataccaactgagctaa |
25598617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 6723067 - 6723133
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
6723067 |
gtggtagtcgaggttcgaaccctggaccttgcatatattatacattgtccatatcaactgagttaaa |
6723133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 43043154 - 43043220
Alignment:
| Q |
111 |
gtggtggtcgggg-tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
43043154 |
gtggtggtcgggggtttgaaccccggaccttgcatacattatgcattgtctataccaaccgagctaa |
43043220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 1861811 - 1861864
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1861811 |
gtttgaaccatggaccttgcatatattatgcattgtccatatcagctgagctaa |
1861864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 7350617 - 7350552
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || |||||||||| ||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
7350617 |
gtggtggtcaggatttgaaccctagactttgcatatattatgcattgtccataccaactgagctaa |
7350552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 31543083 - 31543018
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| |||||||||| |||||| || ||||||||| |
|
|
| T |
31543083 |
gtggtggttggggtttgaaccccggaccttgcatatattatgcattatccataccatctgagctaa |
31543018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 346111 - 346179
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||| | || | |||||||||||| |
|
|
| T |
346111 |
ttggtagtggtcggggtttgaaccctggaccttacatatattatgcattattcaaaccaactgagctaa |
346179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 4509595 - 4509543
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4509595 |
tttgaaccttggaccttgcatatattatgcattgtccatatcaaccgagctaa |
4509543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 5168566 - 5168630
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
5168566 |
ttggtggtagtcggggtttgaaccccgaaccttgcatatattatgcattatccctatcaactgag |
5168630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 6765684 - 6765616
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
6765684 |
ttggtggtggtcgtggttcgaaccccggaccttacatattttatgcattgtccataccaactgagctaa |
6765616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 20200776 - 20200724
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
20200776 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgttcata |
20200724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 24593450 - 24593382
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || ||||| |||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
24593450 |
ttggtggtgttcagggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
24593382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 36474836 - 36474768
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
36474836 |
ttggtggtggccggaatttgaaccccggaccttgcatattttatgcattgtccctatcaactgagctaa |
36474768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 42791369 - 42791301
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
42791369 |
ttggtagtggccggggtttgaaccccggaccttgcatatattatgcattgtccaagtcaagtgagctaa |
42791301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 44526198 - 44526134
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||||||| || ||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgtatattatgcattgtccataccaactgagctaa |
44526134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 19976225 - 19976158
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
19976225 |
gtggtggtcgaggttcgaaccccggaccttgcatattattatgcattgtccataccaactgagctaaa |
19976158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 32458367 - 32458312
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
32458367 |
gtcggagtttgaaccctggaccttgcatatattatgcattgttcttatcaactgag |
32458312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 175
Target Start/End: Original strand, 41778931 - 41778998
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| |||| || ||||| |||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
41778931 |
ttggtggtggccgggattcgaacctcggaccttgcatatattatgcattgtccaaatcaactgagcta |
41778998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 160
Target Start/End: Original strand, 18693655 - 18693701
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcattgtcc |
18693701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 19967490 - 19967424
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||| | | |||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
19967490 |
ggtggtggtcgaggtttgaactccgaaccttgcacatattatgcattgttcatatcaactgagctaa |
19967424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 20990894 - 20990952
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| ||| ||||| |
|
|
| T |
20990894 |
gtggtggtcggggtttgaaccctgaaccttgcatattttatgcattgtctataacaact |
20990952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 107 - 172
Target Start/End: Complemental strand, 27848233 - 27848167
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||| |||||||| ||||| ||| |||||||| |
|
|
| T |
27848233 |
attggtggtggccggggtttgaaccccggaccttgcatatattatgcatttgtcaataccaactgag |
27848167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 29133474 - 29133540
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
29133474 |
gtggtggtcggggttcgaaccctagatcttgcatattttatgcattgttcataccaactgagctaaa |
29133540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 35820290 - 35820356
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
35820290 |
ggtggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtccctaccaactgagctaa |
35820356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 40853811 - 40853873
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcatatttcatatcaactgagctaa |
40853873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 2257042 - 2256981
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactgag |
2256981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 3197071 - 3197135
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
3197071 |
tggtggtcggggtttgaatcc-gaaccttgcatatattatgcattgtccctaccaactgagctaaa |
3197135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 11560561 - 11560504
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
11560561 |
cggggtttgaaccctgaaccttgcatatattatgcattgtccctaccaattgagctaa |
11560504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 20455962 - 20455897
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| || |||||| |||||||||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccataccaattgagctaa |
20455897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 21482506 - 21482575
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| ||||| |||| ||| || ||||||||||||| |
|
|
| T |
21482506 |
ttggtggtggtcggggttcaaaccccggaccttgcatatattatacattatccttaccaactgagctaaa |
21482575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 24579670 - 24579723
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| | ||||| |||||| |
|
|
| T |
24579670 |
gtttgaaccctggaccttgcatatattatgcattgtccaaaccaactaagctaa |
24579723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 25612283 - 25612344
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
25612283 |
gtggtggtcgggggttgaatcccggaccttgcatatattatgcattgtccatacaaactgag |
25612344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 36648780 - 36648845
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
36648780 |
gtggtggtcggggtttaaaccctagaccttgcatatcctattcattgtccataccaactgagctaa |
36648845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 41763876 - 41763933
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||| |||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
41763876 |
cggggtttgaaccccggaccgtgcatatactatgcattgtccataccaactgagctaa |
41763933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 41859922 - 41859857
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgagttaaa |
41859857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 179
Target Start/End: Complemental strand, 4138062 - 4137994
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaagt |
179 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||| |||||||| || ||| ||||||||||| |
|
|
| T |
4138062 |
gtggtggtcggggtttgaatctcggaccttgcatatattatacattgtccttaccaattgagctaaagt |
4137994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 15427750 - 15427698
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
15427750 |
tttgaaccctagaccttgcatatattatatattgtccatatcaactgagctaa |
15427698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 22571868 - 22571920
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
22571868 |
tttgaaccccggacattgcatatattatgcattgtctatatcaactgagctaa |
22571920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 23407008 - 23407072
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||||||||||| | |||| |||||| |
|
|
| T |
23407008 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcattgtccaaaccaaccgagcta |
23407072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 25395429 - 25395493
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||| |||||||||||| | || |||||||| |
|
|
| T |
25395429 |
ttggtggtggtcgggatttgaaccttgaaccttgcatatattatgcattgttcctaccaactgag |
25395493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 29600013 - 29599945
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||| ||| |||||||||| |||| | |||||||||||| |
|
|
| T |
29600013 |
ttggtagtggtcggagtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaa |
29599945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 30089119 - 30089055
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| || ||||||||||| |||||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagctaa |
30089055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 30125723 - 30125659
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| || ||||||||||| |||||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagctaa |
30125659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 34977274 - 34977214
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||| ||| | |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgtccataccaactgag |
34977214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 42066786 - 42066718
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || |||| ||||| |||||||||||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
42066786 |
ttggtggtggccgaggttcaaaccccggaccttgcatatattgtgcattgtccataccaactgagctaa |
42066718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 122 - 177
Target Start/End: Complemental strand, 12124605 - 12124550
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaaa |
12124550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 163
Target Start/End: Complemental strand, 25625790 - 25625735
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||| |||||| |||||||||| |
|
|
| T |
25625790 |
ttggtggtggtccgggtttgaaccccggaccttacatatattatgaattgtccata |
25625735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 171
Target Start/End: Original strand, 29896281 - 29896344
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
29896281 |
ttggtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtttctatcaactga |
29896344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 175
Target Start/End: Original strand, 40994768 - 40994831
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
40994768 |
tggtggtcggtgtttgaaccccgaaccttgcatctattatgtattgtccatatcaattgagcta |
40994831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 139 - 177
Target Start/End: Complemental strand, 4958696 - 4958658
Alignment:
| Q |
139 |
ttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4958696 |
ttgcatacattatacattgtccatatcaactgagctaaa |
4958658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 7262874 - 7262812
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||||||||| | | || |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7262874 |
gtggccggggtttgaatctttgatcttgtatatattatgcattgtccatatcaactgagctaa |
7262812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 8091151 - 8091209
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||||||||||||||| | |||||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcattgtccatacctactgag |
8091209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 115 - 177
Target Start/End: Original strand, 35281205 - 35281267
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||| |||| ||||| |||||||||||||| |
|
|
| T |
35281205 |
tggtcggggtttgaacctcgaaccttgcatatattatacattatccatttcaactgagctaaa |
35281267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 35685067 - 35685117
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
35685067 |
gaaccctagaccttgcatatattatgcattgtccttaccaactgagctaaa |
35685117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 36359374 - 36359328
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaac |
168 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcattgtccaaatcaac |
36359328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 177
Target Start/End: Complemental strand, 39761485 - 39761443
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
39761485 |
gaccttgcatatattatgcattgtccttatcaactgagctaaa |
39761443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 145011 - 145068
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaag |
178 |
Q |
| |
|
|||||| ||||||| ||||| |||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
145011 |
gggtttaaaccctgaaccttacatatattatgcattgtccataccaactgagttaaag |
145068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 176
Target Start/End: Original strand, 3113721 - 3113782
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||| || |||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
3113721 |
tggtcgggatttgaatcccggaccttgcatattttatgcattgtccttatcaactgaactaa |
3113782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 4238830 - 4238765
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||| |||||| | ||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
4238830 |
gtggtggtcggagttcgaaccccgaaccttacatatattatgcattgtccatactaactgagctaa |
4238765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 4927447 - 4927504
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| |||||| || |||||||||||| |
|
|
| T |
4927447 |
cggggtttgaaccccggaccttacatatattatgctttgtccctaccaactgagctaa |
4927504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 7052848 - 7052779
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
7052848 |
ttggtggtgtccggggtttgagccccggaccttgcatattattatgcattgtccttaccaactgagctaa |
7052779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 10195652 - 10195717
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| || |||||||||| | || |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10195652 |
gtggtgatcagggtttgaactccagatcttgcatatattatgcattatccatatcaactgagctaa |
10195717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 12599855 - 12599916
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
12599855 |
gtggtggtcggggttcgaaccccagaccttgcatatattatgtattgtccatactaactgag |
12599916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 14364109 - 14364064
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| |||||||| |
|
|
| T |
14364109 |
gaaccctggaccttacatatattatgcattgtccataccaactgag |
14364064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 20120719 - 20120776
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||||||| | |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
20120719 |
cgggatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
20120776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 22267586 - 22267518
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
22267586 |
ttggtggtggtcggggtttgaactcaa-accttgcatatattatgcattgtccgtaccaactgagttaaa |
22267518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 22523002 - 22523067
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| |||||||| | |||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
22523002 |
gtggtggccgggatttgaacctcgaaccttgcatatattatgtattgtccataccaactgagctaa |
22523067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 24581007 - 24581072
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
24581007 |
gtggtggtcggggtttgaacctcgaaccttgcatatattatgcattgtttttatgaactgagctaa |
24581072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 28771656 - 28771587
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||| ||||| ||| |||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
28771656 |
ttggtggtgtccggggttcgaaccgcggatcttgcatatattatgcattgtccttaccaactgagctaaa |
28771587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 29872162 - 29872227
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||| |||||| ||||| |||| ||||||| |||| |
|
|
| T |
29872162 |
gtggtggtcgaggtttgaaccttagaccttgcatatattatgtattgttcataccaactgaactaa |
29872227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 31477045 - 31476976
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||| ||||||||| | |||||| ||| |||||||||| ||| || ||||||||||||| |
|
|
| T |
31477045 |
ttggtggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctaccaactgagctaaa |
31476976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 34685970 - 34686019
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| | |||||||||||| |
|
|
| T |
34685970 |
gaaccccggaccttacatacattatgcattgtccaaaccaactgagctaa |
34686019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 34708391 - 34708440
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| | |||||||||||| |
|
|
| T |
34708391 |
gaaccccggaccttacatacattatgcattgtccaaaccaactgagctaa |
34708440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 120 - 177
Target Start/End: Original strand, 43117189 - 43117246
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcattgtccttaccaactgagctaaa |
43117246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 44694751 - 44694698
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| | ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
44694751 |
cggggtttgaaccccgagccttgcatatattatgcattgtctatatcaactgag |
44694698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 4180771 - 4180723
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4180771 |
ttggtagtggtcggggtttgaaccccggaccttgcatattttatgcatt |
4180723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 5980274 - 5980234
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
5980274 |
gaccttgcatatattatgcattgtccttatcaactgagcta |
5980234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 8728890 - 8728846
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
8728890 |
gtggtggtcggggtttgaaccctggatcttgcatattttatgcat |
8728846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 9064580 - 9064640
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||||||||| || |||||||| |
|
|
| T |
9064580 |
tggtggtcggggtttgaaccctgaaccttgcataaggtacgcattgtccctaccaactgag |
9064640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 9383224 - 9383264
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
9383224 |
accttgcatatattatgcattgtccataccaactgagctaa |
9383264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 9519729 - 9519769
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
9519729 |
accttgcatatattatgcattgtccatatcaattgagctaa |
9519769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 10156091 - 10156023
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| || |||| | | |||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
10156091 |
ttggtggtggtcgggattcgaacaccgaaccttgcatatattatgtattgtccttaccaactgagctaa |
10156023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 172
Target Start/End: Complemental strand, 19160007 - 19159951
Alignment:
| Q |
116 |
ggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||| | | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
19160007 |
ggtcggagtttgaactccgaaccttgcatatattatgcattgttcatatcaactgag |
19159951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 25561984 - 25562052
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||||||| || |||||||| ||||||| ||||| || |||||||||||| |
|
|
| T |
25561984 |
ttggtggtggtcggagtttgaaccccagatcttgcatattttatgcactgtccttaccaactgagctaa |
25562052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 28202359 - 28202303
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
28202359 |
ggggtttgaacttcggaccttacatatattatgcattgtccctatcaactgagctaa |
28202303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 30243324 - 30243256
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || ||||||||||| | |||||| ||| ||||||||||||| || |||||||||||| |
|
|
| T |
30243324 |
ttggtggtggccgaggtttgaaccccgaaccttgtatatattatgcattgtctctaccaactgagctaa |
30243256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 163
Target Start/End: Original strand, 36264469 - 36264521
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||||||||||||||| | || ||||||| |||||||||| |||||| |
|
|
| T |
36264469 |
gtggtggtcggggtttgaaccccgaactttgcatatattatgcattatccata |
36264521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 36441157 - 36441221
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||| |||||| ||||| |||| |||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
36441157 |
gtggtggtcagggttttaaccccggacaatgcatatattatgcattgtctataccaactgagcta |
36441221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 36615024 - 36615084
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| | ||| ||||||||||| |||||||| |
|
|
| T |
36615024 |
tggtggtcggggtttaaaccttagaccttgcatatactatccattgtccataccaactgag |
36615084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 37852081 - 37852037
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37852081 |
gtggtggttagggtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 176
Target Start/End: Original strand, 39068715 - 39068763
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39068715 |
aaccccggatcttgcatatattatgcattgtccttatcaactgagctaa |
39068763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 42347742 - 42347690
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
42347742 |
ttggtagtggtcggagtttgaacactggaccttgcatattttatgcattgtcc |
42347690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 174
Target Start/End: Original strand, 833083 - 833122
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
833083 |
gaccttgcatatattatgcattgtccataccaactgagct |
833122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 170
Target Start/End: Complemental strand, 11175856 - 11175797
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactg |
170 |
Q |
| |
|
||||||| ||| |||||||||| || |||||||| ||||||||||||||||| |||||| |
|
|
| T |
11175856 |
gtggtggccggagtttgaaccccagatcttgcatatattatgcattgtccataccaactg |
11175797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 172
Target Start/End: Original strand, 17789605 - 17789656
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| |||||||||| |||||||| |
|
|
| T |
17789605 |
gggtttgaaccctggaccttgtatattttatgtattgtccataccaactgag |
17789656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 21870885 - 21870944
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21870885 |
gtggtggtcggggttcgaaccccgaaccttgcatattattatgcattgtccataccaact |
21870944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 122 - 177
Target Start/End: Complemental strand, 30978422 - 30978367
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| |||||| ||| ||||||||| |
|
|
| T |
30978422 |
ggtttgaacccctgaccttgcatatattatgcattatccataccaattgagctaaa |
30978367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 33567730 - 33567667
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| | ||||||||| ||| |||||||||||| |
|
|
| T |
33567730 |
ggtggccggggtttgaaccctggaacttgcatatttcatgcattgttcatgccaactgagctaa |
33567667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 138 - 177
Target Start/End: Original strand, 34464426 - 34464465
Alignment:
| Q |
138 |
cttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
34464426 |
cttgcatatattatgcattgtccataccaactgagctaaa |
34464465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 34469861 - 34469920
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| |||||||||| | |||||||| |
|
|
| T |
34469861 |
ggtggtggtcggggttcgaaccccggaccttgcataagctatgcattgttcttatcaact |
34469920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 158
Target Start/End: Complemental strand, 38904132 - 38904085
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
38904132 |
gtggtggttagggtttgaaccctgaaccttgcatatattatgcattgt |
38904085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 112 - 174
Target Start/End: Complemental strand, 3617162 - 3617100
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||| || |||||||||||||| || ||| |||||| |
|
|
| T |
3617162 |
tggtggccggagtttgaaccctggactttgcgtatattatgcattgtccttaccaattgagct |
3617100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 3903853 - 3903891
Alignment:
| Q |
131 |
cctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
3903853 |
cctggaccttgcatatattatgcattgtccaaatcaact |
3903891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 4557761 - 4557819
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||| ||||||||||| ||||||| |||| ||||||||||||| ||| ||||| |
|
|
| T |
4557761 |
gtggtggtcagggtttgaaccacggaccttacatatattatgcattgtctataccaact |
4557819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 6141275 - 6141225
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
6141275 |
gaaccctagaccttgcatatattatgcattgtccttaccaactgagataaa |
6141225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 7645704 - 7645766
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||| ||| || ||||||||||| |||||||| |
|
|
| T |
7645704 |
gtggtggccgaggtttgaaccctggactttgcatatattaatacattgtccataccaactgag |
7645766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 9581277 - 9581334
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
9581277 |
gtggtggccagggtttgaaccc-ggaccttgcatatattattcattgtccataccaact |
9581334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 10332264 - 10332330
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||| |||||||| |||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10332264 |
ggtggtggcggggttttgaacctccgaccttccatatattatgcattgtccttatcaactgagctaa |
10332330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 12124732 - 12124690
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
12124732 |
ggaccttgcatatattatgcattgtccttaccaactgagctaa |
12124690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 12413556 - 12413498
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| ||||||| ||| |||| |
|
|
| T |
12413556 |
cggggtttgaacctcagaccttgcatatattatgcattgtccttatcaaccgagataaa |
12413498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 12425616 - 12425558
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| ||||||| ||| |||| |
|
|
| T |
12425616 |
cggggtttgaacctcagaccttgcatatattatgcattgtccttatcaaccgagataaa |
12425558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 22559052 - 22558982
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||| ||| |||||||||||||| | |||||||| |||| |
|
|
| T |
22559052 |
attggtggtggtcgggttttgaactccagaccttgtatattttatgcattgtccaaaccaactgagttaaa |
22558982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 23719006 - 23718940
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||| |||||| |||| || ||||||||||||||| |
|
|
| T |
23719006 |
gtggtggtcggagtttgaacaccagaccttgcatattttatgcgttgttcaaatcaactgagctaaa |
23718940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 24106678 - 24106612
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||| |||||| |||| || ||||||||||||||| |
|
|
| T |
24106678 |
gtggtggtcggagtttgaacaccagaccttgcatattttatgcgttgttcaaatcaactgagctaaa |
24106612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 173
Target Start/End: Original strand, 35287666 - 35287716
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
35287666 |
gtttaaaccccggaccttgcatctattatgcattgtccctatcaactgagc |
35287716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 35456810 - 35456876
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||| ||| ||||||||| | || |||||||||||| |
|
|
| T |
35456810 |
gtggtggttggggtttgaaccccgaaccttgcatatattaatgcattgttcttaccaactgagctaa |
35456876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 41526777 - 41526831
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||| ||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
41526777 |
ggttcgaaccccagaccttgcatatactatgcattgtccatgtcaactgagctaa |
41526831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 3708764 - 3708715
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
3708764 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
3708715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 4122027 - 4122068
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
4122027 |
gaccttgcatatattatgcattgtccataccagctgagctaa |
4122068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 4897614 - 4897553
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| | ||||||||||| | |||||||||| |||||||||||||| || |||||||| |
|
|
| T |
4897614 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactgag |
4897553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 4945008 - 4944947
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| | ||||||||||| | |||||||||| |||||||||||||| || |||||||| |
|
|
| T |
4945008 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactgag |
4944947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 5028919 - 5028862
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
5028919 |
cggggtttgaaccccaaaccttacatatattatgcattgtcctaatcaactgagctaa |
5028862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 7206188 - 7206131
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
7206188 |
cggggtttaaacctcggaccttgcatatattatgcattgtctctaccaactgagctaa |
7206131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 7302155 - 7302196
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
7302155 |
gaccttgcatattttatgcattgtccctatcaactgagctaa |
7302196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 7537180 - 7537120
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| |||||| |||| | |||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
7537180 |
gtggtggttggggtt-gaactccggaccttgcatatattatgcattgttcctatcaactgag |
7537120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 11868652 - 11868701
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
11868652 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
11868701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 16204831 - 16204868
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16204831 |
gaccttgcatatattatgcattgtccttatcaactgag |
16204868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 17142901 - 17142836
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||| ||||| ||||||| || |||||||||||| |
|
|
| T |
17142901 |
gtggtggtcggggtttgaactccagactttgcatatattatacattgtcactaccaactgagctaa |
17142836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 19179064 - 19179105
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
19179064 |
gaccttgcatatattatgcattgtccttaccaactgagctaa |
19179105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 159
Target Start/End: Complemental strand, 22709153 - 22709108
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtc |
22709108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 24305311 - 24305360
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24305311 |
gaaccccgaaccttgcatattttatgcattgtccatattaactgagctaa |
24305360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 24393292 - 24393251
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
24393292 |
gaccttgcatatattatgcattgtccttaacaactgagctaa |
24393251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 25274819 - 25274884
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||| |||||| |||||| |||| |||||||||||| | || |||||||||||| |
|
|
| T |
25274819 |
gtggtgttcggggttcgaaccccagaccttacatatattatgcattgttcttaccaactgagctaa |
25274884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 29798507 - 29798568
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
29798507 |
gtggtggtcggggttcgaacccctgaccttaaatattttatgcattgtccataccaactgag |
29798568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 33424315 - 33424380
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||| | | | |||||||| |||||||| ||||| |||||| |||||||| |
|
|
| T |
33424315 |
gtggtggttggggtttgaactccgaatcttgcatatattatgcactgtccctatcaattgagctaa |
33424380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 35360045 - 35360094
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
35360045 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
35360094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 40099397 - 40099438
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
40099397 |
gaccttgcatatattatgcattgtccttaccaactgagctaa |
40099438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 40295456 - 40295509
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
40295456 |
cggggtttgaacctcgaatcttgcatacattatgcattgttcatatcaattgag |
40295509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 40967365 - 40967422
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
40967365 |
tggtcgaggtttgaacctcaaaccttgcatatattatgcattgtccttatcaactgag |
40967422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 41187455 - 41187512
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| |||| ||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
41187455 |
cggggttcgaaccccggactttgcatattttatgcattgtccataccaactaagctaa |
41187512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 43356620 - 43356681
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||| ||| |||||||||||||| || ||||| |
|
|
| T |
43356620 |
ttggtggtggtcggggtttggaccatgaaccttctatatattatgcattgtccctaacaact |
43356681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 44810779 - 44810730
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattg |
157 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
44810779 |
ttggtggtggctggggtttgaaccccggaccttgcatatattatgtattg |
44810730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 3904263 - 3904215
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||||||||| |||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgtccctatcaact |
3904215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 9516996 - 9517064
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || |||| ||| || ||| |||| ||| |||||||||||| |||| |||||||||||| |
|
|
| T |
9516996 |
ttggtggtggccgaggttcgaaacccggatcttgtatatattatgcattgttcataccaactgagctaa |
9517064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 13529069 - 13529002
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||| ||||||||||| | |||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
13529069 |
ttggtagtggtcgaggtttgaaccccg-accttgcatattttatgcattatcctaatcaactgagctaa |
13529002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 15205527 - 15205591
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||| ||| ||||||||||||| |||| ||||||||||||| | | ||||||||||| |
|
|
| T |
15205527 |
gtggtggccggcatttaaaccctggaccttacatatattatgcattgtctaaaccaactgagcta |
15205591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 16877170 - 16877130
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
16877170 |
accttgcatatattatgcattgtccataccagctgagctaa |
16877130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 16989301 - 16989261
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
16989301 |
accttgcatatattatgcattgtccataccagctgagctaa |
16989261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 18231488 - 18231528
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
18231488 |
accttgcatatattatgcattgtccttaccaactgagctaa |
18231528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 22061361 - 22061293
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |||| ||| |||||||| |
|
|
| T |
22061361 |
ttggtggtggccggggtttgaacatcggaccttgcatattttatgtattgtacataccaattgagctaa |
22061293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 24548085 - 24548017
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | ||||| |||||| |||||||| ||| |||||| ||||||| || |||||||||||| |
|
|
| T |
24548085 |
ttggtggtgtccagggttcgaaccccggaccttgaatatattatggattgtccttaccaactgagctaa |
24548017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 28202467 - 28202411
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| || | ||||| |||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
28202467 |
gggtttgaatccggaaccttacatatattatgcattgtccataccaattgagctaaa |
28202411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 137 - 177
Target Start/End: Original strand, 37119274 - 37119314
Alignment:
| Q |
137 |
ccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
37119274 |
ccttgcatatattatgcattgttcatatcaactgagttaaa |
37119314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 41748747 - 41748807
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||| || ||| ||| |||| |||||||||||||||| || ||||| |
|
|
| T |
41748747 |
tggtggtcggggtttgaatcccggatcttacatattttatgcattgtccataccagctgag |
41748807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 7e-22; HSPs: 144)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 19163526 - 19163591
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
19163526 |
gtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccataccaactgagctaa |
19163591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 27718885 - 27718949
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27718885 |
tggtggtcggagtttgaactccggaccttgcatatattatgcattgtccatatcaactgagctaa |
27718949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 32051519 - 32051587
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
32051519 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagctaa |
32051587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 108 - 171
Target Start/End: Original strand, 12800887 - 12800950
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
12800887 |
ttggtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccataccaactga |
12800950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 12748975 - 12748913
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactg |
170 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
12748975 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactg |
12748913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 7997011 - 7996946
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
7997011 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgcgttgtccataccaactgagctaa |
7996946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 19260566 - 19260635
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
19260566 |
ttggtggtggccggggtttgaaccccggaccttacatatattatgcattgtacatatcaactaagctaaa |
19260635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 29652288 - 29652223
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcattgttcttatcaactgagctaaa |
29652223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 27587295 - 27587227
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| || ||||||||||| || |||||||||||| |
|
|
| T |
27587295 |
ttggtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttaccaactgagctaa |
27587227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 108 - 163
Target Start/End: Original strand, 26932750 - 26932805
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
26932750 |
ttggtggtggtcgtggtttgaaccctggaccttgcatatatcatgcattgtccata |
26932805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 33482147 - 33482205
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
33482147 |
cgggatttgaaccctggaccttgcataaattatgcattgtccctatcaactaagctaaa |
33482205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 8717466 - 8717531
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| || ||||||||||| | |||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaaa |
8717531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 8881346 - 8881297
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgtcc |
8881297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 24023698 - 24023763
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||| |||| |||||| ||||||| |||| |
|
|
| T |
24023698 |
gtggtggtcggggtttgaaccccggaccttgcagacattatacattatccataccaactgacctaa |
24023763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 11709056 - 11708992
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctaccaactgagctaa |
11708992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 22775702 - 22775634
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| | |||||||||||| |||||||||||| ||||||||||||||| | ||||| |||||| |
|
|
| T |
22775702 |
ttggtggtggccagggtttgaaccccggaccttgcataaattatgcattgtccaaaccaactaagctaa |
22775634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 29499845 - 29499777
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
29499845 |
ttggtggtgtttggggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctaa |
29499777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 10871895 - 10871942
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10871895 |
ggtttgaaccccggaccttgcatacattatgcattgtccataccaact |
10871942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 24195318 - 24195255
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
24195318 |
ggtgatcggagtttgaaccccggaccttgcatatattatgtattgttcatatcaactgagctaa |
24195255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 175
Target Start/End: Original strand, 24838157 - 24838224
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
24838157 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcctaaccaactgagcta |
24838224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 6235541 - 6235607
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||||||| || ||||||| |||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcatcgtccataccaactgagctaaa |
6235607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 8999881 - 8999947
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| ||||| || |||||||||||| |
|
|
| T |
8999881 |
gtggtggtcggggtttgaaccctggactttgcatatattatgcatttgtctctaccaactgagctaa |
8999947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 14303232 - 14303170
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| ||||| ||||||||| ||| ||||| ||||||||||| ||||||||||||| |
|
|
| T |
14303232 |
tggtcggggttcgaaccttggaccttgtatatattatacattgtccataccaactgagctaaa |
14303170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 30427790 - 30427737
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
30427790 |
ggtttgaacc-tggaccttgcatatattatgcattgtccataccaactgagctaa |
30427737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 444484 - 444419
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||| ||||| |||||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
444484 |
gtggtggccggggtttaaaccccggaccttgcatatattatgcattgtccttaccaattgagctaa |
444419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 6038265 - 6038330
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||| |||||||| | |||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
6038265 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtccatatcaactgagctaa |
6038330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 112 - 173
Target Start/End: Original strand, 26991748 - 26991809
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26991748 |
tggtggtcgtggtttgaaccacaaaccttgcatatattatgcattgtccatatcaactgagc |
26991809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 29376972 - 29376911
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
29376972 |
gtggtggtcggggtttgaactccagaccttgcatatattacgcattgtccataccaactgag |
29376911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 32944830 - 32944891
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
32944830 |
gtggtggtcggggtttgaacctcagaccttgcatattttatgcattgtccataccaactgag |
32944891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 36059348 - 36059417
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
36059348 |
ttggtggtgtccggggttcgaaccctcgaccttgcatatattgatgcattgtctatatcaactgagctaa |
36059417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 37749990 - 37750055
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| ||||||| ||||| |||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
37749990 |
tggtggccggggttcaaaccccggactttgcatatattatgcattgttcatatcaactgagctaaa |
37750055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 8461823 - 8461891
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
8461823 |
ttggtagtggtcggggtttgaactccggaccttgcatattttatgcattgtcccaaccaactgagctaa |
8461891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 13357428 - 13357492
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| || |||||||||| | |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
13357428 |
ttggtggtggccgaggtttgaacctcgtaccttgcatatattatgcattgtccataccaactgag |
13357492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 15001262 - 15001326
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| |||||||||||| | | |||||||| |
|
|
| T |
15001262 |
ttggtggtggccggggtttgaaccttggaccttgcatattttatgcattgtcgaaaccaactgag |
15001326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 164
Target Start/End: Complemental strand, 23159511 - 23159459
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
164 |
Q |
| |
|
||||||||||||||||||||| | | |||||||| |||||||||||||||||| |
|
|
| T |
23159511 |
tggtggtcggggtttgaaccccgaatcttgcatatattatgcattgtccatat |
23159459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 30623367 - 30623299
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||| |||||||| |||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
30623367 |
ttggtcgtgttcggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaa |
30623299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 37141428 - 37141368
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||| ||| |||||||||| | |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccataccaactga |
37141368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 9478025 - 9478076
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
162 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
9478025 |
gtggtggtcagggtttgatccccagaccttgcatacattatgcattgtccat |
9478076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 13286199 - 13286137
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
13286199 |
ggtggccggggtttgaaccc-ggatcttgcatatattatgcattgtctataccaactgagctaa |
13286137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 171
Target Start/End: Complemental strand, 15020835 - 15020772
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||| | |||||||||||| ||| |||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
15020835 |
ttggtggtggccagggtttgaaccccggatcttgcatatattatacattgtccataccaactga |
15020772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 175
Target Start/End: Original strand, 25136831 - 25136898
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
25136831 |
ttggtggtggccgaggtttgaacctcggaccttgcatattttatgccttgtccataccaactgagcta |
25136898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 175
Target Start/End: Complemental strand, 29908085 - 29908018
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||||| | ||| ||| |||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
29908085 |
ttggtggtggtcagattttaaactctggaccttgcatatattatgcattgtccctaccaactgagcta |
29908018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 171
Target Start/End: Complemental strand, 30218277 - 30218214
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||| |||||||||| ||| | |||| ||||||| |||||||||||| |||||||||||| |
|
|
| T |
30218277 |
ttggtggttgtcggggtttaaactccggacattgcatatattatgcattgttcatatcaactga |
30218214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 32192959 - 32192900
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||| | |||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
32192959 |
gtcggggttcgaaccccgaaccttgcatatattatgcattgtccataccaactaagctaa |
32192900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 39821945 - 39821890
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
39821890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 122 - 177
Target Start/End: Original strand, 42208470 - 42208525
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagctaaa |
42208525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 7553738 - 7553684
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
7553738 |
gtttgaaccttggaccttgcatatattatgcattgtccctaccaactgagttaaa |
7553684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 11053044 - 11052986
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcattgtccatactaactgag |
11052986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 161
Target Start/End: Original strand, 14598188 - 14598238
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
161 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
14598188 |
gtggtggtcggggtttgaaccccgcaccttgcttatattatgcattgtcca |
14598238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 158
Target Start/End: Original strand, 24023402 - 24023452
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24023402 |
ttggtagtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 24695999 - 24696057
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||||||||| | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
24695999 |
gtggtcagggtttgaatctcggatcttgcatatattatgcattgtccatatcaactgag |
24696057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 117 - 171
Target Start/End: Original strand, 31336803 - 31336857
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| | || ||||||| |
|
|
| T |
31336803 |
gtcggggtttgaaccctagaccttgcatatattatgcattgttcctaccaactga |
31336857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 113 - 175
Target Start/End: Complemental strand, 36781477 - 36781415
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
36781477 |
ggtggtcggggtttaaaccccggactttgcatatattatgtattgtccttaccaactgagcta |
36781415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 37938562 - 37938500
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| |||||||| |||| ||||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
37938562 |
tggtcgggatttgaacctcggactttgcatatattatgcattatccataccaactgagctaaa |
37938500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 4830076 - 4830019
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||| || |||||| | |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcattgtccataccaactga |
4830019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 6447247 - 6447194
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcattgtccataccaactgagttaaa |
6447194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 8138002 - 8137941
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
8138002 |
tggtcggggtttgaaccccaaactttgcatattttatgcattgtccataccaactgagctaa |
8137941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 160
Target Start/End: Original strand, 12160431 - 12160468
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12160431 |
gtttgaaccctggaccttgcatacattatgcagtgtcc |
12160468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 12910820 - 12910861
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
12910820 |
gaccttgcatatattatgcattgtccataccaactgagctaa |
12910861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 18533740 - 18533679
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||||| |||||||||||| | || |||||||| |
|
|
| T |
18533740 |
gtggtggttggggtttgaaccccggatcttgcatatattatgcattgttcttaccaactgag |
18533679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 19778120 - 19778071
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
19778071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 26773792 - 26773857
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||| ||||||||| |||| ||| |||| |||||| |
|
|
| T |
26773792 |
gtggtgatcgggatttgaaccctagaccttgcatatattatgcatcgtccttattaactaagctaa |
26773857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 30417600 - 30417665
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| | ||| |||||| ||||| ||||||| ||| |||||||||||| |
|
|
| T |
30417600 |
gtggtggacggggtttgaaccccgaaccatgcatatattatacattgtctataccaactgagctaa |
30417665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 35103165 - 35103112
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
35103165 |
gtttgaacctcggaccttgcttacattatgcattgttcataccaactgagctaa |
35103112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 40167393 - 40167332
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||||||||||| || | |||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
40167393 |
gtggtggccggggtttgaatcccgaaccttgtatatattatgcattgtccataccaactgag |
40167332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 43778093 - 43778024
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||| ||| |||||||| |||| |
|
|
| T |
43778093 |
ttggtggtggtcggagtttgaacctcagaccttgcatattttatgcattgtctataccaactgagttaaa |
43778024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 574454 - 574390
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||| |||| | ||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
574454 |
tggtggtcgaagttcgaactccggaccttacatatattatgcattgtctatatcaactgagctaa |
574390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 172
Target Start/End: Complemental strand, 4263873 - 4263825
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
4263873 |
tttgaacctcggaccttgcatacattatgcattgttcttatcaactgag |
4263825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 177
Target Start/End: Complemental strand, 15664567 - 15664515
Alignment:
| Q |
126 |
tgaaccctggaccttgcatacattatgcattgtcc-atatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
15664567 |
tgaaccctagaccttgcatatattatgcattgtcctataccaactgagctaaa |
15664515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 23852985 - 23852917
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| || |||| |||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
23852985 |
ttggtggtgggcgggattcaaaccacggaccttgcatatattatgcattgtccataccgactgagctaa |
23852917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 26799254 - 26799194
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| ||||||||||||| || |||||||| |
|
|
| T |
26799254 |
tggtggtcggggttttaaccccgaaccttgcatattttatgcattgtccctaccaactgag |
26799194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 29546963 - 29546903
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
29546963 |
tggtggtcagggtttgaaccccagaccttgcatatattatctattgtccctatcaactgag |
29546903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 33105453 - 33105397
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| || | || ||||||||| |
|
|
| T |
33105453 |
ggggtttgaaccccggaccttgcatatattatgcattgttcaaaccagctgagctaa |
33105397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 176
Target Start/End: Original strand, 33451356 - 33451404
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
33451356 |
aacccttgaccttgcatatattatgcattatccataccaactgagctaa |
33451404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 38763505 - 38763569
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| | ||||| |||||| ||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
38763505 |
gtggtggccagggttcgaaccccagaccttgcatatattatgcattgtccaaaccaactgagcta |
38763569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 41625264 - 41625200
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| ||||||| |||||| |||| |||||||||| | |||| |||||||||||| |
|
|
| T |
41625264 |
tggtggttggggttcgaaccctagaccttacatatattatgcattattcataccaactgagctaa |
41625200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 163
Target Start/End: Complemental strand, 7718774 - 7718719
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||| ||| ||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
7718774 |
ttggtggtgttcgaagttcgaaccttggaccttgcatatattatgcattgtccata |
7718719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 176
Target Start/End: Original strand, 9655989 - 9656052
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||| ||||| |||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
9655989 |
ggtggttggggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagctaa |
9656052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 171
Target Start/End: Complemental strand, 10601837 - 10601774
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||| |||| ||||||||||| || | | |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
10601837 |
ttggttgtggccggggtttgaatcccgaatcttgcatatattatgcattgtccataccaactga |
10601774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 30176406 - 30176453
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30176406 |
ttggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 122 - 177
Target Start/End: Original strand, 32115407 - 32115462
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| | ||||| |||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
32115407 |
ggtttgaaccccgaaccttacatatattatgcattgtccatattaactgaactaaa |
32115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 32421630 - 32421579
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| |||||||||| |||||||| |
|
|
| T |
32421630 |
gggtttgaaccccggaccttgcatatattatatattgtccataccaactgag |
32421579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 164
Target Start/End: Original strand, 34645078 - 34645129
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatat |
164 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcattgtccatat |
34645129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 6314336 - 6314378
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
6314336 |
ggaccttgcatattttatgcattgtccttatcaactgagctaa |
6314378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 158
Target Start/End: Complemental strand, 6471585 - 6471535
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
|||||||||| |||||||||||||| | || ||||||| |||||||||||| |
|
|
| T |
6471585 |
ttggtggtggccggggtttgaaccccgaacattgcatatattatgcattgt |
6471535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 8043941 - 8043875
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| || |||||||| | | |||||||||| ||||||| |||| | |||||||||||||||| |
|
|
| T |
8043941 |
gtggtggttggagtttgaactccgaaccttgcatatattatgcgttgtacctatcaactgagctaaa |
8043875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 117 - 175
Target Start/End: Original strand, 11479633 - 11479691
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||| |||||||||| |||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
11479633 |
gtcgggatttgaaccctaaaccttgcatattttatgcattgtctataccaactgagcta |
11479691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 175
Target Start/End: Complemental strand, 12061659 - 12061593
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata-tcaactgagcta |
175 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
12061659 |
ggtggtggtcggactttgaaccctgaaccttgcatatattatatattgtccatacccaactgagcta |
12061593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 128 - 170
Target Start/End: Original strand, 22948088 - 22948130
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaactg |
170 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
22948088 |
aaccccggaccttgcatatattatgcattgtccctatcaactg |
22948130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 23093397 - 23093332
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| | | || ||||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
23093397 |
ggtggtggtcggggttcgtatcccagaccttgcatatattatacattgtccata-caactgagctaa |
23093332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 27750905 - 27750959
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||| ||||| || |||||||||||| |
|
|
| T |
27750905 |
ggttcgaaccccggaccttgcatatattatgcactgtccttaccaactgagctaa |
27750959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 31085877 - 31085919
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
31085877 |
ggaccttacatacattatacattgttcatatcaactgagctaa |
31085919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 32555317 - 32555259
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||| || |||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
32555317 |
cggggttcgaaccttgaaccttgcatattttatgcattgtccataccaactaagctaaa |
32555259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 173
Target Start/End: Complemental strand, 33763870 - 33763824
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
33763870 |
gaaccctgtaccttgcatatattatgcattgtccttatcaattgagc |
33763824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 34997522 - 34997464
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| ||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
34997522 |
cggggttcgaacccatgaccttgcatatatttatgcattgtctatatcaactgagctaa |
34997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 40919362 - 40919415
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| | || ||||||||||||| |
|
|
| T |
40919362 |
gtttgaaccc-ggaccttgcatatattatgcattgttcctaccaactgagctaaa |
40919415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 44067980 - 44068049
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| |||||| |||||||||| | ||||||||||| || |||||||||||| ||||||||||||||| |
|
|
| T |
44067980 |
ttggtgatggtcgtggtttgaacc-tcgaccttgcatatttttatgcattgtccacatcaactgagctaaa |
44068049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 112 - 174
Target Start/End: Original strand, 44084263 - 44084324
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
44084263 |
tggtggccgaggtttgaaccc-ggaccttgcatatattatgcattgttctaatcaactgagct |
44084324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 44632175 - 44632240
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||||| | ||||| ||| |||||||||||| |||| |||||||| |||| |
|
|
| T |
44632175 |
gtggtggtcggggtttgaaccccgaaccttatatatattatgcattgt-cataccaactgagttaaa |
44632240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 172
Target Start/End: Complemental strand, 498778 - 498741
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
498778 |
gaccttgcatatattatgcattgtccataccaactgag |
498741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 1244703 - 1244760
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| ||||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
1244703 |
cggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgagctaa |
1244760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 1877676 - 1877713
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
1877676 |
gaccttgcatatattatgcattgtctatatcaactgag |
1877713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 2060610 - 2060541
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggacctt-gcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||||| | |||||| ||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
2060610 |
ttggtggtgtccggggtttgaactcacgacctttgcatatattatgcattgttcttatcaactgagctaa |
2060541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 2554226 - 2554267
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2554226 |
gaccttgcatattttatgtattgtccatatcaactgagctaa |
2554267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 159
Target Start/End: Original strand, 3672609 - 3672654
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3672609 |
gtggtcggggtttgaaccctaaaccttgcatattttatgcattgtc |
3672654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 4600269 - 4600334
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| |||||| |||||||| ||| |||||| || ||||| |||||||| || ||||||||||||| |
|
|
| T |
4600269 |
tggttgtcgggatttgaaccttggtccttgcctatattatacattgtccctaccaactgagctaaa |
4600334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 11771777 - 11771713
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| |||| | |||||||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
11771777 |
gtggtggtcgaggttcgaactc-ggaccttgcatatattatgtattgtctctatcaactgagctaa |
11771713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 124 - 177
Target Start/End: Original strand, 12714373 - 12714426
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcattgtcccttccaactgagctaaa |
12714426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 12770434 - 12770377
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| || || |||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
12770434 |
cggggttcgaaccccggcccctgcataaattatgcaatgtccctatcaactgagctaa |
12770377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 13575363 - 13575294
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| || |||| ||||| ||| |||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
13575363 |
ttggtggtggccgaggttcgaacctcggaacttgcatatgttatgcattgtccctaccaactgagctaaa |
13575294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 14279558 - 14279627
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| | ||| |||||| | |||||||||| |||||||||||| ||| |||||||| |||| |
|
|
| T |
14279558 |
ttggtggtggtcagagttcgaaccccgaaccttgcatattttatgcattgtctataccaactgagttaaa |
14279627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 16704522 - 16704453
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| | || ||| |||||||||||||| || ||||||||| |
|
|
| T |
16704522 |
ttggtggtggccggggtttgaaccccggacctcacttatattcatgcattgtccataccagctgagctaa |
16704453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 17704060 - 17704019
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
17704060 |
gaccttgcatatattatgcattgtccttaccaactgagctaa |
17704019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 17898150 - 17898089
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||||||| ||| || |||||||||||| |||||| ||||||||| |||||||| |
|
|
| T |
17898150 |
gtggtggccggggttagaatcccggaccttgcatatattatgttttgtccataccaactgag |
17898089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 18942981 - 18942924
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| || ||||| |||||| |||||||||| ||| || |||||||||||| |
|
|
| T |
18942981 |
cggggtttgaaacccggaccatgcatatattatgcattatccctaccaactgagctaa |
18942924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 20665353 - 20665402
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
20665353 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20665402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 27426673 - 27426734
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
27426673 |
ttggtggtggccggggtttgaactcccgaccttgtatattttatgcattgtcaatatcaact |
27426734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 30550716 - 30550765
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
30550716 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
30550765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 145
Target Start/End: Complemental strand, 30845028 - 30844991
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcata |
145 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
30845028 |
ttggtggtggtcggggtttgtaccatggaccttgcata |
30844991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 38139313 - 38139244
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
38139313 |
ttggtggtgtccggggttcgaacccacgaccttgcatatatttatacattgtctatatcaactgagctaa |
38139244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 39433481 - 39433416
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||| ||| |||||| ||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
39433481 |
gtggtggccggcgttcgaaccccagaccttgcatattttatgtattgttcatatcaactgagctaa |
39433416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 39486100 - 39486169
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcataca-ttatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||||| | |||| ||||||| ||| |||||||||||| |
|
|
| T |
39486100 |
ttggtggtgctcggggttcgaacccgcgaccttgcatatatttatacattgtctataacaactgagctaa |
39486169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 40679719 - 40679784
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| |||| |||| ||||| |||||||||||| |
|
|
| T |
40679719 |
gtggtggccgaggtttgaaccccggaccttgcatattttatatattgaccataccaactgagctaa |
40679784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 44215465 - 44215514
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
44215465 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44215514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 44293646 - 44293581
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||| |||||| || ||| |||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
44293646 |
gtggtggtcagggttcgaaccccagatcttacatatattatgcattgtctataccaactgagctaa |
44293581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 1764945 - 1765005
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||| |||||| ||| |||||||| |||||| |||| ||||||||||||| |
|
|
| T |
1764945 |
tggtggttggggttcgaaccccggatcttgcatattttatgcgttgttcatatcaactgag |
1765005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 118 - 177
Target Start/End: Complemental strand, 1921785 - 1921725
Alignment:
| Q |
118 |
tcggggtttgaaccctggaccttgcataca-ttatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| |||||| |||||||||||| | |||||||||||| |||||||| ||||||| |
|
|
| T |
1921785 |
tcggggttcgaaccccggaccttgcatatatttatgcattgtcgctatcaacttagctaaa |
1921725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 2188616 - 2188556
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||| |||||||||| |||||| |||||||||| | ||| ||||||||||| |||||||| |
|
|
| T |
2188616 |
tggtagtcggggtttaaaccctataccttgcatatactatccattgtccataccaactgag |
2188556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 5251007 - 5251059
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
5251007 |
tttgaaccatggaccttgcatattttatgcattgctcatatcaattgagctaa |
5251059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 6109240 - 6109180
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||| ||| ||||||||| | |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6109240 |
gtggtggccggagtttgaaccacgaaccttgtatattttatgcattgtccatatcaactga |
6109180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 171
Target Start/End: Original strand, 7968931 - 7968990
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||| ||| ||||||||| |||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
7968931 |
gtggtggctgggatttgaaccc-ggaccttgcatatattatgcattgtccttaccaactga |
7968990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 9598670 - 9598618
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||||| ||||||||| || ||||| |||||||||| ||||| |||| |
|
|
| T |
9598670 |
gtggtggtcgggatttgaaccccgggccttggatacattatgtattgttcata |
9598618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 119 - 163
Target Start/End: Original strand, 13124361 - 13124405
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
13124361 |
cggggtttgaaccccggaccttgcatattttatgcattgttcata |
13124405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 15438507 - 15438459
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcattgtccttaccaagtgagctaa |
15438459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 15529811 - 15529763
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcattgtccttaccaagtgagctaa |
15529763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 16869597 - 16869537
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||| |||| ||||||||| | || ||||| | ||||||||||||||||| ||||||| |
|
|
| T |
16869597 |
gtggtggccgggatttgaaccccgaactttgcaaatattatgcattgtccataccaactga |
16869537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 21557503 - 21557443
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| || ||||| ||||||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
21557503 |
tggtggtcgggattcgaacctcggaccttacatatattatgcattgtccatactaactgag |
21557443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 28436538 - 28436602
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||| ||||| || |||| |||||||||||| ||||||| |||||||| |
|
|
| T |
28436538 |
tggtggtcggagtttgaactttggactttacatatattatgcattgttgatatcaattgagctaa |
28436602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 33373751 - 33373803
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| |||||| |||| |||||| |||||||||| |||||||| |
|
|
| T |
33373751 |
ggggtttgaaccccagaccttacatatattatgaattgtccataccaactgag |
33373803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Complemental strand, 33996140 - 33996092
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||| |||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
33996140 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcattgtc |
33996092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 37873047 - 37872983
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| ||||| | |||||||||| |||||||||| ||||| |||||||||||| |
|
|
| T |
37873047 |
tggtggccggggttcgaaccacgtaccttgcatattttatgcattgaccataccaactgagctaa |
37872983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 39076595 - 39076543
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||||||| || ||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
39076595 |
attggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
39076543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 39077081 - 39077029
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||||||| || ||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
39077081 |
attggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
39077029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 42172233 - 42172281
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||||| ||||||||||| | ||| |||||||| ||||||||||||| |
|
|
| T |
42172233 |
gtggtggttggggtttgaactccggatcttgcatatattatgcattgtc |
42172281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 7e-22; HSPs: 180)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 11949753 - 11949818
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
11949753 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
11949818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 9946501 - 9946433
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
9946501 |
ttggtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
9946433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 19479468 - 19479532
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgttcatattaactgagctaa |
19479532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 8607198 - 8607137
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||||||||||||| | ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8607198 |
gtggtagtcggggtttgaactccggaccttacatacattatgcattgtccatatcaactgag |
8607137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 19588225 - 19588160
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
19588225 |
gtggtggccggggtttgaaccctggaccttgcatattttatgcattgtccataccaattgagctaa |
19588160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 20383559 - 20383494
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20383559 |
gtggtggatggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
20383494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 21318243 - 21318304
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
21318243 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgag |
21318304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 23810020 - 23809955
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
23810020 |
gtggtggccggggtttgaaccctgaaccttgcatatattatgctttgtccataccaactgagctaa |
23809955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 24664981 - 24665046
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
24664981 |
gtggtggtcggggttcgaaccccggaccttgcatatattatgcattctccataccaactgagctaa |
24665046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 28435235 - 28435304
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
28435235 |
ttggtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaaa |
28435304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 5924723 - 5924655
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| |||| |||||| |||||||||| |||||||||||| |
|
|
| T |
5924723 |
ttggtggtggtcgaggtttgaaccccggaccttccatatattatgtattgtccatagcaactgagctaa |
5924655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 16470375 - 16470311
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||| ||||||| |
|
|
| T |
16470375 |
gtggtggtcggggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagcta |
16470311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 22040711 - 22040655
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| | |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgtccatatcaactgagctaaa |
22040655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 38453339 - 38453271
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
38453339 |
ttggtggtggctggggttcgaaccctggaccttgcatatattatgcattgtccatgccaactgagctaa |
38453271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 39171370 - 39171425
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39171370 |
gggtttgaaccctgaaccttgcatattttatgcattgtccatatcaactgagctaa |
39171425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 36490639 - 36490581
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
36490639 |
gtggtggtcgggatttgaaccccggatcttgcatacattatgcattgtccataccaact |
36490581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 43374265 - 43374327
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||| | | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcatattttatgcattgtccatatcaactgagctaa |
43374327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 49041971 - 49042029
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtctatatcaact |
49042029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 50362140 - 50362194
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcattgtccctaccaactgagctaa |
50362194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 3936698 - 3936633
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgagctaa |
3936633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 7230351 - 7230286
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
7230286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 16304089 - 16304154
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| || |||||||| || |||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtccataccaactgagctaaa |
16304154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 21114295 - 21114352
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaac |
168 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| || |||||||||||||| |||| |
|
|
| T |
21114295 |
gtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtccataccaac |
21114352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 23775589 - 23775524
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||||||||| || |||||| ||||| |
|
|
| T |
23775589 |
gtggtggttggggttcgaaccctggaccttgcatatattatgcattgtccctaccaactgtgctaa |
23775524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 25115116 - 25115059
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
25115116 |
tggtcggggtttgaaccctgaaccttgcatatgttatgcattgtccataccaactgag |
25115059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 56551582 - 56551647
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
56551582 |
gtggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagctaa |
56551647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 56564973 - 56565038
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
56564973 |
gtggtgttcggggttcgaaccctagaccttgcatattttatgcattgtccatatcaattgagctaa |
56565038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 675980 - 675924
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagctaa |
675924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 836222 - 836290
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||| |||||||||| || |||||||||||| |
|
|
| T |
836222 |
ttggtggtggtcggagtttgaacctcggaccttgcatatattttgcattgtccctaccaactgagctaa |
836290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 14202466 - 14202530
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| |||||||||| |||| |||||||||| |
|
|
| T |
14202466 |
ttggtagtggtcggggtttgaaccccggaccttacatatattatgcattatccaaatcaactgag |
14202530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 20799381 - 20799449
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | |||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
20799381 |
ttggtggtgaccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
20799449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 31760320 - 31760252
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||||| ||||| ||||||| ||| |||||||||||| |
|
|
| T |
31760320 |
ttggtggtggttggagtttgaactctggaccttgcatatattatacattgtctataccaactgagctaa |
31760252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 43034329 - 43034393
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
43034329 |
ttggtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccataccaactgag |
43034393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 53190365 - 53190301
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||| || ||||||||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
53190365 |
tggtgggcgggattcgaaccctggaccttgcatatattatgcattatccataccaactgagctaa |
53190301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 8027387 - 8027453
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| |||||||||| ||| || ||||||||||||| |
|
|
| T |
8027387 |
gtggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttaccaactgagctaaa |
8027453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 11198399 - 11198333
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
11198399 |
gtggtggccggggtttgaaccccggaccttgcatatattatgccttgtccattctaactgagctaaa |
11198333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 35021460 - 35021522
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35021460 |
gtggtcggggttcgaaccccgaaccttgcatattttatgtattgtccatatcaactgagctaa |
35021522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 47814244 - 47814306
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatgtgttgtccataccaactgagctaa |
47814306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 897487 - 897430
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||| ||||||||||| ||||||||||||| |
|
|
| T |
897487 |
ggggtttgaaccccggaccttacatatattatacattgtccataccaactgagctaaa |
897430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 16431679 - 16431622
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
16431679 |
cggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgagctaa |
16431622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 17729497 - 17729432
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| || |||| |||||||||||| |
|
|
| T |
17729497 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgcaaggttcataccaactgagctaa |
17729432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 19908763 - 19908702
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
19908763 |
gtggtggtcggggttcgaacctcggaccttgcatatattatgcattgtccttaccaactgag |
19908702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 35287497 - 35287562
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
35287497 |
gtggtggccggggttggaaccccggaccttgcatattttatgcattgttcataccaactgagctaa |
35287562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 171
Target Start/End: Original strand, 8415485 - 8415545
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||| ||||||||||| |||| ||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
8415485 |
gtggtggtcagggtttgaaccttggatcttacatatattatgcattgtccataccaactga |
8415545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 10148253 - 10148189
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||| || ||||||||| ||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
10148253 |
ttggtagtggccgaggtttgaactctgaaccttgcatatattatgcattgtccaaatcaactgag |
10148189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 21317325 - 21317393
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
21317325 |
ttggtggtggttgaggtttgaacccctgaccttgcatatattatgcattgtctctaccaactgagctaa |
21317393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 23304003 - 23304071
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||| | |||| |||||||||||| ||||||| |||||| || |||||||||||| |
|
|
| T |
23304003 |
ttggtggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctaccaactgagctaa |
23304071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 43722826 - 43722770
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcattgtccataccaactgagttaaa |
43722770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 54857602 - 54857670
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||| ||| |||| ||||||| |
|
|
| T |
54857602 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtttataccaaccgagctaa |
54857670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 55061111 - 55061043
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||| || ||||| |||||| |
|
|
| T |
55061111 |
ttggtggtggtcggaatttgaacccccgaccttgcatatattatgcattgtccgtaccaactaagctaa |
55061043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 55421560 - 55421624
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| || | ||||||||| |||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
55421560 |
tggtggtcaggatctgaaccctgaaccttgcatatattatgcattgtccaaaccaactgagctaa |
55421624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 123 - 166
Target Start/End: Original strand, 49953405 - 49953448
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatca |
166 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcattgtccatatca |
49953448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 281651 - 281597
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
281651 |
ggtttgaaccccggacctttcatatattatgcattgtccataccaactgcgctaa |
281597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 174
Target Start/End: Complemental strand, 9783973 - 9783907
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||| || |||||||||| |||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
9783973 |
ttggtggtggccgaggtttgaacctcagaccttacatatattatgcattgtccatatcaactaagct |
9783907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 12322733 - 12322679
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgtccgtaccaactgagctaa |
12322679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 12671738 - 12671804
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||| |||||| ||| |||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
12671738 |
gtggtggtcgaggttcgaaccccggatcttgcatattttatgcattgtctataccaactgagctaaa |
12671804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 14577505 - 14577563
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| | |||| ||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
14577505 |
cggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagctaaa |
14577563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 19854625 - 19854571
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||| ||| |||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
19854625 |
ggttcgaaccccggatcttgcatatattatgcattgtccataccaactgagctaa |
19854571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 157
Target Start/End: Original strand, 30850374 - 30850420
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattg |
157 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
30850374 |
gtggaggtcggggtttgaaccctgaaccttgcatatattatgcattg |
30850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 131 - 177
Target Start/End: Complemental strand, 34247491 - 34247445
Alignment:
| Q |
131 |
cctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
34247491 |
cctggaccttgcatatattatgcattgtccttaccaactgagctaaa |
34247445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 34969383 - 34969441
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||| ||||| |||||||||| |
|
|
| T |
34969383 |
gtggtggtcggagtttgaaccctgaaccttgcatatattatatattgttcatatcaact |
34969441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 36203284 - 36203242
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36203284 |
ggaccttgcatatattatgcattgtccttatcaactgagctaa |
36203242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 37921809 - 37921751
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| || |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
37921809 |
cggggtttgaatcccggaccttgcatatattatgcattgtccttactaactgagctaaa |
37921751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 39093565 - 39093631
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||| |||||||||||||| || ||| ||||||||| |
|
|
| T |
39093565 |
gtggtagtcggggtttgaaccctaaactttgcatatattatgcattgtccttaccaattgagctaaa |
39093631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 47266223 - 47266157
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||| ||||| ||||||| ||| ||||||| ||||| |
|
|
| T |
47266223 |
gtggtggtcggggtttgaatcctagaccttacatatattatacattgtctataccaactgatctaaa |
47266157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 2186347 - 2186388
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
2186347 |
gaccttgcatatattatgcattgtccataccaactgagctaa |
2186388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 107 - 176
Target Start/End: Complemental strand, 6087822 - 6087753
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||||| |||||||||| || ||| |||||||||||| |
|
|
| T |
6087822 |
attgatggtggctggggtttgaaccccagaccttgcatatattatgcattatctataccaactgagctaa |
6087753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 7371546 - 7371599
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
7371546 |
cggggttcgaaccccggaccttgcatatattatgtattgtccttatcaactgag |
7371599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 8495058 - 8494993
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| ||||||| | ||| |||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
8495058 |
gtggtggccgggatttgaactcgggatcttgcatatattatgcattgtccctaccaactgagctaa |
8494993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 128 - 169
Target Start/End: Complemental strand, 9196267 - 9196226
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
9196267 |
aaccctggacctggcatatattatgcattgtccatatcaact |
9196226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 12698644 - 12698603
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12698644 |
gaccttgcatatattatgcattgtccaaatcaactgagctaa |
12698603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 18915037 - 18915102
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| || |||||| ||||| || ||| |||||||||||||| || ||||||||||||| |
|
|
| T |
18915037 |
tggtggtcgggattcgaaccccggaccatgaatatattatgcattgtccttaccaactgagctaaa |
18915102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 19347335 - 19347376
Alignment:
| Q |
137 |
ccttgcatacattatgcattgtccatatcaactgagctaaag |
178 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19347335 |
ccttgcatattttatgcattgtccatatcaactgagctaaag |
19347376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 22164260 - 22164325
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| |||||||||||| | || ||||| ||||||| |
|
|
| T |
22164260 |
tggtggtcggggtttgaaccccagaccttacatatattatgcattgttcctaccaactaagctaaa |
22164325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 23247588 - 23247653
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||| ||||||| ||||||||| |||| ||||||| |
|
|
| T |
23247588 |
gtggtggccggggtttaaaccccagaccttgcatatattatgcgttgtccataccaaccgagctaa |
23247653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 24079830 - 24079879
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
24079830 |
gtggtggtcggggtttgaactccggaccttgcatattttatgcattgtcc |
24079879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 122 - 171
Target Start/End: Complemental strand, 26033335 - 26033286
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||| ||||||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
26033335 |
ggtttaaaccctgaagcttgcatatattatgcattgtccatatcaactga |
26033286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 29908127 - 29908066
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
29908127 |
gtggtgatcgaggtttgaactccggaccttgcatatattatgcattgtccttaccaactgag |
29908066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 32180901 - 32180836
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
32180901 |
gtggtggtcggggttcgaaccccagactttgcatattttatgcattgtctataccaactgagctaa |
32180836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 33495639 - 33495578
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||||| |||||| ||||| |||| ||||| |
|
|
| T |
33495639 |
ttggtggtggttggggtttgaaccctgaatcttgcatatattatgtattgttcataccaact |
33495578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 34042314 - 34042265
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattg |
157 |
Q |
| |
|
||||||||||||| ||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
34042314 |
ttggtggtggtcgaggtttgaaccccgaaccttgcatatattatgcattg |
34042265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 37193308 - 37193255
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
37193308 |
gtttgaaccccggaccttgcatatattatacattgtccatactaactgagctaa |
37193255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 40070962 - 40071019
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
40070962 |
tggtcggggtttgaacttcggaccttgcatatattatgcattgttcataccaactgag |
40071019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 42845096 - 42845047
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
42845096 |
gtggtggtcggagttttaaccccggaccttgcatatattatgcattgtcc |
42845047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 43155146 - 43155085
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
43155146 |
tggtcggggtttgaacctcagatcttgcatatattatgcattatccataacaactgagctaa |
43155085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 46676504 - 46676553
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
46676553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 49021836 - 49021771
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
49021836 |
tggtggtcggggttcgaatcctagaccttgcatattttatgtattgtccataccaactgcgctaaa |
49021771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 52270044 - 52270085
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
52270044 |
gaccttgcatatattatgcattgtccataccaactgagctaa |
52270085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 54500640 - 54500575
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | |||||||||| ||||||| |||| ||||||||||||| || |||||||||||| |
|
|
| T |
54500640 |
gtggtggtcagtgtttgaaccccggaccttacatatattatgcattgtctctaccaactgagctaa |
54500575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 177
Target Start/End: Original strand, 2649733 - 2649789
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||| | |||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
2649733 |
gggttcgaactccggaccttgcatatattatgcattgtccctaccaactgagctaaa |
2649789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 7248397 - 7248341
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
7248397 |
gggtttgaaccctagaccttgcatattttatgcattgtcccaatcaactgagttaaa |
7248341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 10336976 - 10337024
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||| ||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
10336976 |
gtggtgttcggggtttgaaccccgaaccttacatacattatgcattgtc |
10337024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 10401387 - 10401451
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| || |||||||||||||||||||||| |||||||||| |||| ||||||| |||| |
|
|
| T |
10401387 |
tggtggtcaggatttgaaccctggaccttgcatattgtatgcattgttcataccaactgaactaa |
10401451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 12439710 - 12439670
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12439710 |
accttgcatatattatgcattgtccttatcaactgagctaa |
12439670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 18094476 - 18094432
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18094476 |
gtggtggttagggtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 177
Target Start/End: Original strand, 19935169 - 19935217
Alignment:
| Q |
129 |
accctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| ||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
19935169 |
accctcgaccttgcatagattatgcattgttcttatcaactgagctaaa |
19935217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 21449886 - 21449953
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||| || ||||||||| | | || |||||||||| |
|
|
| T |
21449886 |
ttggtggtggccggg-tttgaaccctggaccttgcatatatcatgcattgttcctgtcgactgagctaa |
21449953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 22411823 - 22411771
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| | ||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
22411823 |
gtttgaaccccgaaccttacatatattatgcattgtccataccaactgagcta |
22411771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 22630351 - 22630411
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtcactaccaactgag |
22630411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 41521024 - 41520964
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||| ||||||||||||| || |||||||| |
|
|
| T |
41521024 |
tggtggtcggagtttgaaccttgaaccttgcatatattatgcattgtctctaccaactgag |
41520964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 42139913 - 42139849
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||||||||||||| |||| |||||| ||||||||||||||||| ||| | ||||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgtccataccaaataagctaaa |
42139849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 42756121 - 42756161
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42756121 |
accttgcatatattatgcattgtccttatcaactgagctaa |
42756161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 43782296 - 43782360
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
43782296 |
tggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgtcattaccaactgagctaa |
43782360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 44724457 - 44724393
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||| |||||||| ||||||||| |||| |||||||| |
|
|
| T |
44724457 |
ttggtggtggtcaggggttgaaccctatacctcgcatacatcatgcattgttcataccaactgag |
44724393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 47015559 - 47015623
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||| ||||||| ||| ||||||||||||||||| |||||| |||| |
|
|
| T |
47015559 |
tggtggtcggagtttgaaccccagaccttgtatatattatgcattgtccatactaactgaactaa |
47015623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 47806243 - 47806295
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
47806243 |
ttggtggtgttcggggttcgaaccccagaccttgcatatattatgcattgtcc |
47806295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 49473707 - 49473651
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||| |||||||||||| |||||||||||||| || |||||| ||||| |
|
|
| T |
49473707 |
ggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgggctaa |
49473651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 56497595 - 56497663
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| || |||||| ||||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
56497595 |
ttggtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccttaccaattgagctaa |
56497663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 16743285 - 16743339
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||| || ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16743285 |
gggtttgaatcctgtac-ttgcatatattatgcattatccatatcaactgagctaa |
16743339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 158
Target Start/End: Original strand, 37930837 - 37930884
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37930837 |
gtggtggtcggggtttgaacctcagaccttgcatatattatgcattgt |
37930884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 49308881 - 49308826
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||| ||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
49308881 |
gggttcgaaccccagaccttgcatatattatgcattgtccttgtcaactgagctaa |
49308826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 2431068 - 2431002
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||| ||| ||||||||||||| |
|
|
| T |
2431068 |
gtggtggtcggggtttgaacctcataccttgcatattttatgtattgtcaataccaactgagctaaa |
2431002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 2888945 - 2888879
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||| || |||||| || |||||||||||| |
|
|
| T |
2888945 |
gtggtggccggggtttgaaccgcggaccttgcatatattatacatttgtccctaccaactgagctaa |
2888879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 172
Target Start/End: Original strand, 6459937 - 6459975
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
6459937 |
ggaccttacatatattatgcattgtccatatcaactgag |
6459975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 10564463 - 10564521
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| |||||| |||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
10564463 |
cggggtttgaacctcagaccttacatatattatgtattgtccataccaactgagctaaa |
10564521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 18138337 - 18138267
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||| ||| |||||||| | ||||||||||||||||| |
|
|
| T |
18138337 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatttatgcattgactatatcaactgagctaaa |
18138267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 18903748 - 18903814
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||| |||||||||| | |||||||||||||||| |
|
|
| T |
18903748 |
gtggtggtcagggtttgaaccccagaccttacatatattatgcattatttttatcaactgagctaaa |
18903814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 32139403 - 32139345
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| |||||||||||| ||| ||| ||||||| ||||||||||||||| |
|
|
| T |
32139403 |
cggggttcgaaccccggaccttgcatatatttatgtattgtccctatcaactgagctaa |
32139345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 33413320 - 33413386
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| ||| |||||||| | |||| ||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33413320 |
gtggtgatcgaggtttgaatctcggacattgaatatattatgcattgtccttatcaactgagctaaa |
33413386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 147 - 177
Target Start/End: Complemental strand, 35998034 - 35998004
Alignment:
| Q |
147 |
attatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35998034 |
attatgcattgtccatatcaactgagctaaa |
35998004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 38298009 - 38297952
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||| ||||||||||||||||||||| |||| |
|
|
| T |
38298009 |
gtggtcggggttcgaacccag-accctgcatatattatgcattgtccatatcaattgag |
38297952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 38375028 - 38374970
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||| |||||||||||||| || ||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccctaccaact |
38374970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 49125546 - 49125476
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||| ||| |||||||| | ||||||||||||||||| |
|
|
| T |
49125546 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatttatgcattgactatatcaactgagctaaa |
49125476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 49949405 - 49949340
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||| || |||||| | |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
49949405 |
ggtggtggccgggattcgaacccag-accttgcatatattatgcattgtccttaccaactgagctaa |
49949340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 173
Target Start/End: Complemental strand, 50656665 - 50656607
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||| |||| |||||||||||| |||| |||| |
|
|
| T |
50656665 |
tggtcagggttcgaaccctagaccttgcatatattaagcattgtccataccaaccgagc |
50656607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 156
Target Start/End: Original strand, 54294411 - 54294457
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
54294411 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 163
Target Start/End: Complemental strand, 6610331 - 6610282
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |||| |||||| |
|
|
| T |
6610331 |
gtggtcggggtttgaaccccagaccttgcatatattatacattatccata |
6610282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 6789432 - 6789481
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||||| | |||||||||||| || |||||||||||| |
|
|
| T |
6789432 |
gaaccccggaccttgcatatactatgcattgtccttaccaactgagctaa |
6789481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 9392995 - 9392938
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||| ||| |||| || ||||||||||| ||| ||||||| |||| |
|
|
| T |
9392995 |
ggggtttgaaccctggatcttacatatataatgcattgtccttattaactgagttaaa |
9392938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 10261759 - 10261808
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
10261759 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
10261808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 15988491 - 15988430
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| ||| | |||||||||||| || ||||| |
|
|
| T |
15988491 |
ttggtggtggtcgaggttcgaaccccggaccttgtatatagtatgcattgtccttaccaact |
15988430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 16584951 - 16585004
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| | | |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
16584951 |
gtttgaactccgaaccttgcatattttatgcattgtccatatcaattgagctaa |
16585004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 17423179 - 17423228
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcattgtctctaccaactgag |
17423228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 20403182 - 20403223
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
20403182 |
gaccttgcatatattatgcattgttcctatcaactgagctaa |
20403223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 20681196 - 20681127
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
20681196 |
ttggtggtgtccggggtttgaacctgcgaccttgcatatatttatacattgtctatatcaactgagctaa |
20681127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 21562696 - 21562647
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
21562696 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
21562647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 21935062 - 21935017
Alignment:
| Q |
132 |
ctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
21935062 |
ctggaccttacatacattatgcattgtctataccaactgagttaaa |
21935017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 23628836 - 23628771
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||||| ||| || |||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
23628836 |
ttggtggtgtccggggttcgaaaccaggaccttgcatatatttatgcattgtctatatcaactgag |
23628771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 160
Target Start/End: Original strand, 25783451 - 25783488
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcattgtcc |
25783488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 26097724 - 26097793
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcataca-ttatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||||| | |||| |||||| |||||||||||||||| |
|
|
| T |
26097724 |
ttggtggtgttcggggttcgaacccgcgaccttgcatatatttatacattgtatatatcaactgagctaa |
26097793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 26926700 - 26926749
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
26926700 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
26926749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 177
Target Start/End: Original strand, 29808283 - 29808324
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
29808283 |
accttgcatatattatgcattgtccttatcaactgatctaaa |
29808324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 30135211 - 30135150
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| ||| || |||| |||||||||| ||| ||||||||||| |
|
|
| T |
30135211 |
gtggtggtcggggtttgaacctcggatctgacatatattatgcattatccttatcaactgag |
30135150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 31780815 - 31780751
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
31780815 |
gtggtggttggggtttgaatt-tggaccttgcatattttatgcattgtccttaccaactgagctaa |
31780751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 43330217 - 43330168
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
43330217 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
43330168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 43499662 - 43499597
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||| |||| ||||||||||| ||| | |||||| |
|
|
| T |
43499662 |
gtggtggccggggtttgaaccccggaccttgtatattttatacattgtccataccaattaagctaa |
43499597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 43702343 - 43702384
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
43702343 |
gaccttgcatatattatgtattgtccctatcaactgagctaa |
43702384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 48171952 - 48171891
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||| ||||||| || |||||||| |
|
|
| T |
48171952 |
gtggtggtcggggtttgaacctagaaccttgcatatattatacattgtctctaccaactgag |
48171891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 48226496 - 48226553
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
48226496 |
cgggatttgaaccccagaccttgcatattttatgcattgtccataccaattgagctaa |
48226553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 177
Target Start/End: Original strand, 48251923 - 48251964
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||| |
|
|
| T |
48251923 |
accttgcatatattatacattgttcatatcaactgagctaaa |
48251964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 49952571 - 49952620
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||| ||||| |||| |
|
|
| T |
49952571 |
gtttgaaccccggaccttacatatattatgcattgtccaaatcaattgag |
49952620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 50650933 - 50650982
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
50650933 |
gaaccctgaaccttacatatattatgcattgtccttatcaaccgagctaa |
50650982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 51450283 - 51450234
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
51450283 |
gtggtggccggggtttgaactccggaccttgcatatcttatgcattgtcc |
51450234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 52620639 - 52620570
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||| ||| |||||| ||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
52620639 |
ttggtggtgtccggagttcgaacccgcgaccttgcatatatttatgcattgtctatatcaactgagctaa |
52620570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 119 - 171
Target Start/End: Original strand, 1753350 - 1753402
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
1753350 |
cggggtttgaacccccgaccttgcatatgttatgcattgtccttaccaactga |
1753402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 8020661 - 8020701
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
8020661 |
gaccttgcatatattatgcattgtccaaaccaactgagcta |
8020701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 10204886 - 10204846
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10204886 |
accttacatatattatgcattgtccataccaactgagctaa |
10204846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 10303498 - 10303566
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| || |||| |||||| ||| |||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
10303498 |
ttggtagtggccgaggttcgaaccccggatcttgcatattttatgcattgtccttaccaactgagctaa |
10303566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 11144652 - 11144716
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
11144652 |
ttggtggtgtccggggttcaaaccccagaccttgcatatattatgcattgtctttatcaactgag |
11144716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 14197422 - 14197482
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| | ||||||||||| ||| ||| |||| |||||||||||||| || |||||||| |
|
|
| T |
14197422 |
tggtggttgaggtttgaaccccggatcttacatatattatgcattgtccctaccaactgag |
14197482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 14542747 - 14542799
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||| || ||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
14542747 |
ttggtggtgttcagggttcgaaccccagaccttgcatatattatgcattgtcc |
14542799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 16686174 - 16686222
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||| | ||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
16686174 |
gtttgaactccggaccttacctatattatgcattgtccatatcaactga |
16686222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 17728153 - 17728089
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||| |||||||| || |||| ||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
17728153 |
gtggtggccggaatttgaaccatgaacctagcatatattatgcattatccataccaactgagcta |
17728089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 19997354 - 19997402
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||| |||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
19997354 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcattgtc |
19997402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 23160099 - 23160047
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||||| || ||||||||||| |
|
|
| T |
23160099 |
gtttgaacctcggaccttacatatattatgcattgtccctaccaactgagcta |
23160047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 173
Target Start/End: Complemental strand, 27740809 - 27740749
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||||||| ||| |||| | | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
27740809 |
ggtggtcggagttcgaactccgaaccttgcatattttatgcattgtctatatcaactgagc |
27740749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 29681444 - 29681512
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| |||| ||||| ||| ||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
29681444 |
ttggtggtggtcgaggttcgaacctcagacattgcatattttatgcattgtccataccaactgaactaa |
29681512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 30051882 - 30051922
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
30051882 |
accttgcatatattatgcattgtccataacaactgaactaa |
30051922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 119 - 163
Target Start/End: Original strand, 31138991 - 31139035
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
31138991 |
cggggtttgaacctcggaccttgcatattttatgcattgtccata |
31139035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 36035900 - 36035840
Alignment:
| Q |
116 |
ggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||| |||||||| ||| |||||||||| |||| | ||||||||||| |
|
|
| T |
36035900 |
ggtcggagtttgaaccccggaccttggatatattatgcattatccaaactaactgagctaa |
36035840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 36479057 - 36478997
Alignment:
| Q |
116 |
ggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||| | ||||| |||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
36479057 |
ggtcggggttcgaacctcgaaccttacatatattatgcattgtccataccaacagagctaa |
36478997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 135 - 171
Target Start/End: Complemental strand, 44221494 - 44221458
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
44221494 |
gaccttgcatatattatgcattgtccataccaactga |
44221458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 46434750 - 46434814
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||| |||| ||||||||| ||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
46434750 |
gtggtgatcggagtttgaacctcaaaccttacatatattatgcattgtccttatcaactgagcta |
46434814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 172
Target Start/End: Complemental strand, 46745236 - 46745200
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
46745236 |
accttgcatatattatacattgtccatatcaactgag |
46745200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 48694649 - 48694689
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
48694649 |
ggggtttgaactctggaccttgcatatattatgcactgtcc |
48694689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 49952658 - 49952726
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||| |||| |||||||| ||||||||||| |||||||||||||| |||||| ||| |||| |
|
|
| T |
49952658 |
ttggcggtggccgggatttgaaccactgaccttgcatatattatgcattgtccttatcaattgatctaa |
49952726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 52132316 - 52132356
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
52132316 |
gaccttgcatatattatgcattgtccaaaccaactgagcta |
52132356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 53617908 - 53617844
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| |||||||||||||| || |||||||| |
|
|
| T |
53617908 |
ttggtggtggtcggggtttgaacagcagaccttaaatatattatgcattgtccctaccaactgag |
53617844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 54877590 - 54877654
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||| |||||| ||| || |||||||| |||||||||||| |||| |||| ||||||| |
|
|
| T |
54877590 |
tggtggccgggttttgaatcctagatcttgcatatattatgcattgttcataccaaccgagctaa |
54877654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 3e-21; HSPs: 133)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 15889485 - 15889417
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
15889485 |
ttggtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaa |
15889417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 40715939 - 40716004
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaa |
40716004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 3445234 - 3445302
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
3445234 |
ttggtggtggccgggatttgaaccccggaccttgcatacattatgcattgtccttaccaactgagctaa |
3445302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 22522788 - 22522856
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
22522788 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaaccgagctaa |
22522856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 6489081 - 6489013
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
6489081 |
ttggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
6489013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 6624850 - 6624782
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
6624850 |
ttggtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaa |
6624782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 29695089 - 29695025
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
29695089 |
ttggtggtggtcggggtttgaaccacgaaccttacatatattatgcattgtccatatcaactgag |
29695025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 32200438 - 32200502
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
32200438 |
tggtggtcggggcttgaaccccggaccttgcatatattatgcattgtccctgtcaactgagctaa |
32200502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 34436925 - 34436857
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
34436925 |
ttggtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaa |
34436857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 39980582 - 39980514
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
39980582 |
ttggtggtggtcggggtttgaactccggaccttgcatattttatgcattatccataccaactgagctaa |
39980514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 108 - 174
Target Start/End: Complemental strand, 26655538 - 26655472
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
26655538 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagct |
26655472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 108 - 174
Target Start/End: Complemental strand, 26927123 - 26927057
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
26927123 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagct |
26927057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 13864415 - 13864354
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||| ||||| |||| |||||||| |
|
|
| T |
13864415 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgttcataccaactgag |
13864354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 16076498 - 16076441
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
16076498 |
tggtcggggattgaaccctgaaccttgcatatattatgcattgtccatatcagctgag |
16076441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 16701571 - 16701636
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
16701571 |
gtggtggtcggggtttgaatcccggaccttgcatatattattcattgtccctaccaactgagctaa |
16701636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 17090937 - 17090872
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
17090937 |
gtggtggccggggtttgaaccccggaccttgcattaattatgcattatccataccaactgagctaa |
17090872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 37932401 - 37932336
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| | ||||| |||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
37932336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 20721120 - 20721060
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
20721120 |
tggtagtcggggtttgaaccccggaccttgcatatattatgtattgtccataccaactgag |
20721060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 24408569 - 24408501
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| ||||||||| ||||| | |||||||||||| |
|
|
| T |
24408569 |
ttggtagtggtcggggtttgaaccccagaccttgcatatattatgcatcgtccaaaccaactgagctaa |
24408501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 26409323 - 26409259
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| |||||| ||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26409323 |
tggtgggcggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagctaa |
26409259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 111 - 174
Target Start/End: Complemental strand, 35413027 - 35412965
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
35413027 |
gtggtggccggggttcgaaccc-ggaccttgcatatattatgcattgtccatattaactgagct |
35412965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 13409617 - 13409555
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||| | |||||||| ||| |||||||||||| | |||||||||||||||| |
|
|
| T |
13409617 |
tggtcggggtttgaactccggaccttgtatatattatgcattgttcttatcaactgagctaaa |
13409555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 4009941 - 4009872
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||| ||| ||||||||||| || |||||||||||| |
|
|
| T |
4009941 |
ttggtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttaccaactgagctaa |
4009872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 8544979 - 8545040
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||| |||| | |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8544979 |
gtggtggtcggagttcgaactccggaccttgcatatattatgcattgtccttatcaactgag |
8545040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 10704333 - 10704386
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
10704333 |
gtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
10704386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 16579364 - 16579425
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
16579364 |
gtggtggtcagggtttgaaccacggaccttgcatatattatgcattgttcataccaactgag |
16579425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 18331778 - 18331713
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||| |||||||| |||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
18331778 |
gtggtggccggggcttgaaccccggaccttgcatattttatgcattgtccataccaagtgagctaa |
18331713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 27903183 - 27903118
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||| |||||||||||| |||| ||||||| ||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcattgttcataccaactgaactaaa |
27903118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 40959073 - 40959008
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| ||||||||||||| ||| ||| |||||||| |
|
|
| T |
40959073 |
gtggtggtcggggtctgaaccctgaatcttgcatatattatgcattgtcgataccaattgagctaa |
40959008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 41650930 - 41650990
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
41650930 |
gtggtggtcggtgtttgaactc-ggaccttgcatatattatgcattgtccataccaactgag |
41650990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 11637563 - 11637623
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgtccataccaactgag |
11637623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 11720967 - 11720904
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||| |||||||||||||| || |||||||| |
|
|
| T |
11720967 |
ttggtggtggccggggtttgaaccccg-accttgcatatattatgcattgtccctaccaactgag |
11720904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 20688114 - 20688046
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| | | |||||||| | |||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
20688114 |
ttggtggtggccagagtttgaactccggaccttgcatatattatgcattgtccaaaccaactgagctaa |
20688046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 22555305 - 22555241
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
22555305 |
ttggtggtggtcggggtttgattcccggaccttgcatattatatgcattgtccataccaactgag |
22555241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 25603991 - 25604055
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||| || |||||| | |||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25603991 |
tggtggccgggattcgaaccccgaaccttgcatatattatgcactgtccatatcaactgagctaa |
25604055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 34191507 - 34191439
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
34191507 |
ttggtagtggccggggtttgaaccccggaccttgcatattttatgcattgtcccaaccaactgagctaa |
34191439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 158
Target Start/End: Complemental strand, 14474905 - 14474858
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
14474905 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcgttgt |
14474858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 159
Target Start/End: Complemental strand, 25979914 - 25979867
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25979914 |
tggtggccgaggtttgaaccccggaccttgcatacattatgcattgtc |
25979867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 174
Target Start/End: Original strand, 37021362 - 37021425
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| |||||||||| |||| | ||| |||||| |
|
|
| T |
37021362 |
gtggtggtcggggtttgaaccctgaatcttgcatatattatgcattatccaaaccaattgagct |
37021425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 10531611 - 10531553
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
10531611 |
gtggtagtcggggtttgaaccacggaccgtgcatatattatgcattgtccatagcaact |
10531553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 18147781 - 18147723
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||||||| ||| | |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
18147781 |
cgggggttgaaccccggatcctgcatatattatgcattgtccttatcaactgagctaaa |
18147723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 35270682 - 35270736
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
35270682 |
ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaa |
35270736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 37054259 - 37054325
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||||| | ||||| ||| |||||||||||||| || ||||||||||||| |
|
|
| T |
37054259 |
gtggtggtcggagtttgaaccccgaaccttatatatattatgcattgtccctaccaactgagctaaa |
37054325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 40837896 - 40837954
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcatattttatatattgtccataccaactgag |
40837954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 3671281 - 3671228
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
3671281 |
cggggttcgaaccctggaccttgcatatattatacattatccttatcaactgag |
3671228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 5614835 - 5614775
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
5614835 |
gtggtggt-ggggtttgaacccccgaccttacatatattatgcattatccatatcaactgag |
5614775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 5846092 - 5846035
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
5846092 |
cggggtttgaaccccagactttgcatatattatgcattgtccttaccaactgagctaa |
5846035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 9893661 - 9893726
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
9893661 |
gtggtggctggggtttgaaccccagaccttgcatattttatgcattatctatatcaactgagctaa |
9893726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 11844428 - 11844493
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| | || ||||||| |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
11844428 |
gtggtggtcgagattcgaaccctaaaccttgcatatattatgcattgtccttaccaactgagctaa |
11844493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 13796401 - 13796340
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
13796401 |
gtggtggtcggagtttgtaccccagaccttgcatatattatgcattgttcatatcgactgag |
13796340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 16036886 - 16036833
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
16036886 |
gtttgaaccatggaccttgcatatattatgtattgtccatgccaactgagctaa |
16036833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 17708145 - 17708084
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| | || ||||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17708145 |
gtggtggccaggatttgaactctgaaccttgcatattttatgcattgtccatatcaactgag |
17708084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 17862037 - 17861984
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
17862037 |
tttgaaccctgaactttgcatatattatgcattgtccctaccaactgagctaaa |
17861984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 18391671 - 18391606
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| ||||| |||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
18391671 |
gtggtggtcgaggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagctaa |
18391606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 19068430 - 19068494
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
19068430 |
gtggtgatcggggtttgaacccca-accttgcatatattatgcattatccataccaactgagctaa |
19068494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 22394094 - 22394041
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
22394094 |
gtttgaacctcggatcttacatatattatgcattgtccatatcaactgagctaa |
22394041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 28207203 - 28207138
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| || ||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
28207203 |
gtggtggccgggattcgaacctcggaccttgcatattttatgcattgtccataccaactgagctaa |
28207138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 32234835 - 32234771
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc-atatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
32234835 |
ttggtggtggtcggggtttgaaccc-cgaccttgcatattttatgcattgtccgataccaactgag |
32234771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 176
Target Start/End: Original strand, 39610359 - 39610396
Alignment:
| Q |
139 |
ttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39610359 |
ttgcatatattatgcattgtccatatcaactgagctaa |
39610396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 42817102 - 42817151
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
42817102 |
gtggtggtcgaggtttgaaccccggaccttgtatatattatgcattgtcc |
42817151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 979812 - 979876
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||| ||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
979812 |
ttggtgttggccggggtttgaaccctagacgttgcatatattatgcatcgtctctatcaactgag |
979876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 2839872 - 2839804
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||||||| | |||||| ||| |||||||||| |||| | |||||||||||| |
|
|
| T |
2839872 |
ttggtagtggtcggagtttgaaccccgaaccttggatatattatgcattatccaaaccaactgagctaa |
2839804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 5107236 - 5107296
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| |||||||||| | |||| |||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattattcataccaactgag |
5107296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 10199093 - 10199025
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| || |||||| ||||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10199093 |
ttggtggtggtcgggattcgaaccccacaccttatatatattatgcattgtccataccaactgagctaa |
10199025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 14188322 - 14188390
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| |||||| |||||||||| ||||||| |||| |
|
|
| T |
14188322 |
ttggtggtggtctgggtttgaaccgcggatattgcatatattatggattgtccataccaactgaactaa |
14188390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 173
Target Start/End: Complemental strand, 16094126 - 16094066
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||||||||||||||||||| || ||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcattatccctatcaactgagc |
16094066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 18589855 - 18589918
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||| ||| ||||| |||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
18589855 |
ttggtggtgatcggg-tttaaaccccggaccttgcatatattatgcattgttcataccaactgag |
18589918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 22665190 - 22665258
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| | ||| |||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
22665190 |
ttggtggtggccggggtttgaactccggatcttgcatattttatacattgtccatactaactgagctaa |
22665258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 32559378 - 32559310
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||| |||| |||||||||||| ||||||| |||||||| |
|
|
| T |
32559378 |
ttggtggtggccgggatttgaaccccagaccttacatattttatgcattgtcaatatcaattgagctaa |
32559310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 32858743 - 32858676
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
32858743 |
ttggtggtggccggaatttgaaccctg-accttgcatattttatgcattgtccataccaacggagctaa |
32858676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 140
Target Start/End: Complemental strand, 37884737 - 37884705
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggacctt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37884737 |
ttggtggtggtcggggtttgaaccctggacctt |
37884705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 160
Target Start/End: Complemental strand, 39914970 - 39914923
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
39914970 |
tggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgtcc |
39914923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 42505918 - 42505878
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
42505918 |
accttgcatatattatgcattgtccataccaactgagctaa |
42505878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 122 - 177
Target Start/End: Original strand, 12909167 - 12909222
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| ||||||| ||||| |||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
12909167 |
ggtttaaaccctgaaccttacatatattatgcattgttcataccaactgagctaaa |
12909222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 25796408 - 25796463
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || | ||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
25796408 |
gggtttgaagcccgaaccttgcatacattatggattgtccttaccaactgagctaa |
25796463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 158
Target Start/End: Complemental strand, 27086149 - 27086102
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
27086149 |
gtggtggctggggtttgaaccctggaccttgcatatattatacattgt |
27086102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 31280092 - 31280041
Alignment:
| Q |
109 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
31280092 |
tggtggtggtcgaggtttgaaccccggatattgcatatattatgcattgtcc |
31280041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 31602821 - 31602880
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| | | |||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
31602821 |
gtcggggtttgaatctcgaaccttgcatatattatgcattgttcataccaactgagctaa |
31602880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 177
Target Start/End: Complemental strand, 32622962 - 32622900
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| ||||| || |||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
32622962 |
gtggtcggggttcgaacc-tgaaccttgcatattttatacattgtccataccaactgagctaaa |
32622900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 38495207 - 38495152
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||||| |||||| |||||||| |
|
|
| T |
38495207 |
gtcggggtttgaaccccgaaccttgcatattttatgcattatccataccaactgag |
38495152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 5485246 - 5485192
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||| |||| ||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
5485246 |
ggttagaaccccggacattgcatatattatgcattgtccctaccaactgagctaa |
5485192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 173
Target Start/End: Original strand, 12611025 - 12611087
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
12611025 |
gtggtggtcgaggttcgaaccccagaccttgcatattttatgcattgtccataccaattgagc |
12611087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Original strand, 18489070 - 18489132
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| ||| | ||||||||||| ||||||||||||| ||| ||||||||||||| |
|
|
| T |
18489070 |
tggtcggggttcaaactccagaccttgcatatattatgcattgtctataccaactgagctaaa |
18489132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 21316944 - 21316887
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||||||||| || |||||||| |||| |
|
|
| T |
21316944 |
cggggtttgaaccc-ggacctttcatatattatgcattgtccttaccaactgagttaaa |
21316887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 26166807 - 26166761
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
26166807 |
gtggtcagggtttgaaccctggaccttgcatatttgatgcattgtcc |
26166761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 158
Target Start/End: Complemental strand, 32339809 - 32339759
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
|||||||||| |||| || |||||| |||||||||||| |||||||||||| |
|
|
| T |
32339809 |
ttggtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 33014245 - 33014299
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
33014245 |
ggtttgaaccccagacctttcatatattatgcattgtccacaccaactgagctaa |
33014299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 135 - 177
Target Start/End: Complemental strand, 40446030 - 40445988
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
40446030 |
gaccttgcatatattatgcattgtccttatcaactgagttaaa |
40445988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 41266457 - 41266391
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||| ||||||| | ||||| |||| |||||| |||||| |||||| ||||||||| |
|
|
| T |
41266457 |
gtggtggtcggggtgtgaaccccgaaccttacatatattatgttttgtccttatcaattgagctaaa |
41266391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 42473954 - 42473900
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| | ||||| |||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcattgttccaatcaattgagctaa |
42473900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 42515876 - 42515818
Alignment:
| Q |
114 |
gtggtcggggtttgaa-ccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||| ||||||||||| ||| ||||||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
42515876 |
gtggccggggtttgaatccccggaccttacatatattatgcattgtccataccaactga |
42515818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 781934 - 781873
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||| |||||| ||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
781934 |
gtggtggtcagggttcgaaccccagaccttgcatattttatacattgtccctatcaactgag |
781873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 790133 - 790202
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
790133 |
ttggtggtgttcggggttcgaacctgcgaccttgcatatatttatacattgtctatatcaactgagctaa |
790202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 1669578 - 1669635
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||| ||| ||||||| |||||||||||| | || |||||||||||| |
|
|
| T |
1669578 |
cggggattgaaccctagactttgcatatattatgcattgttcttaccaactgagctaa |
1669635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 2530085 - 2530016
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
2530085 |
ttggtggtgtccggggttcgaacctgcgaccttgcatatatttatgcattgtctatatcaactgagctaa |
2530016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 3389221 - 3389172
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
3389221 |
gtttgaaccccagatcttgcatatattatgcattgtccataccaactgag |
3389172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 5015350 - 5015286
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||||||| | | |||||||||| ||||| |||||||| || ||||||||||||| |
|
|
| T |
5015350 |
tggtggttggggtttgaactccgaaccttgcatatattattcattgtcc-taccaactgagctaaa |
5015286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 8024472 - 8024407
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| | ||| |||||||||| ||||||| |||| |
|
|
| T |
8024472 |
gtggtggtcggggttcaaacccaggaccttgcatatttaatgtattgtccataccaactgaactaa |
8024407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 11310441 - 11310506
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||| ||||| || |||||||| ||||| ||||||||| | |||||||||||| |
|
|
| T |
11310441 |
gtggtggtcagggtttaaaccccagatcttgcatatattatacattgtccaaaccaactgagctaa |
11310506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 12159391 - 12159452
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||| ||||| ||||||| || |||||||| |
|
|
| T |
12159391 |
gtggtggtcggggtttgaatcctgaaccttacatatattatacattgtctctaccaactgag |
12159452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 12190055 - 12189998
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||| |||||||||| ||||| |||||| |
|
|
| T |
12190055 |
cggggtttgaacccccgaccttacatatattatgtattgtccataccaactaagctaa |
12189998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 175
Target Start/End: Original strand, 14948259 - 14948320
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||||| ||||| || ||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
14948259 |
gtggtcggggttcgaacctcgggccttgaatattttatacattgtccatatcaactgagcta |
14948320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 16133079 - 16133120
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
16133079 |
gaccttgcatatattatgcattgtccttaccaactgagctaa |
16133120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 17151832 - 17151897
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||| ||||||| || ||||||| |||| |
|
|
| T |
17151832 |
gtggtggtcggggtttgaatccaagaccttgcatatattatacattgtctctagcaactgaactaa |
17151897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 18749162 - 18749223
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||| ||| |||| ||||| || || |||||| ||||||||||||||||| ||||| |
|
|
| T |
18749162 |
ttggtggtggccggagtttaaaccccgggccgtgcatatattatgcattgtccataccaact |
18749223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 18789107 - 18789042
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||| |||||||||||| || |||||||||||| |
|
|
| T |
18789107 |
gtggtggctggggtttgaaccccgaaccttgcatattttatgcattgtctctaccaactgagctaa |
18789042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 20125096 - 20125048
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
20125096 |
gtggtggtcggagtttgaaccc-gaaccttgcatatattatgcattgtcc |
20125048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 164
Target Start/End: Original strand, 26030441 - 26030494
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
164 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26030441 |
gtggtggccggggttcgaaccccggaccttgcaagtattatgcattgtccatat |
26030494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 30488992 - 30488931
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||| |||||| ||| |||||||||||| |||||||||||| |||| |
|
|
| T |
30488992 |
tggtcggagtttgaaccccaaaccttgtatatattatgcattgttcatatcaactgaactaa |
30488931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 31561331 - 31561395
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||||||||||| ||||| |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
31561331 |
ttggtagtggtcggggttcaaaccc-ggaccttgcatattattatgcattgtccataccaactgag |
31561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 173
Target Start/End: Original strand, 31708133 - 31708198
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||||||| || |||| |||||| ||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
31708133 |
ttggtggtgtccgaggttcgaaccccagaccttgcatatattatgcattgttcataccaactgagc |
31708198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 155
Target Start/End: Complemental strand, 33412159 - 33412118
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33412159 |
gtggccggggtttgaatcctggaccttgcatatattatgcat |
33412118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 37462182 - 37462133
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
37462182 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
37462133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 41630110 - 41630163
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| || | |||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
41630110 |
cggggtttgaatcccgaaccttgcatatattatgcattgtccctatcaattgag |
41630163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 43108624 - 43108579
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| || |||||||| |
|
|
| T |
43108624 |
gaaccctgaaccttgcatatattatgcattgtccttaccaactgag |
43108579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 1808580 - 1808648
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| | ||| | | |||||||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
1808580 |
ttggtggtggtcggggatcgaattccgaaccttgcatattttatgcattatccataccaactgagctaa |
1808648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 6424902 - 6424942
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
6424902 |
ggggtttgaaccccggaccttgtatatattatgcattgtcc |
6424942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 16089520 - 16089456
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| ||| || ||||||||| | ||||||||||||||||| ||||||| |||| |
|
|
| T |
16089520 |
tggtggccggggttcgaatcccagaccttgcaaatattatgcattgtccataccaactgaactaa |
16089456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 17046407 - 17046344
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||| || |||| | ||| |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
17046407 |
ttggtggtggccgggattcgaactc-ggatcttgcatatattatgcattgtccataccaactgag |
17046344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 17210704 - 17210764
Alignment:
| Q |
116 |
ggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||| |||||||||| |||||||| ||||| || |||||||||||| |
|
|
| T |
17210704 |
ggtcggagtttgaaccccacaccttgcatatattatgcactgtccctaccaactgagctaa |
17210764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 17230460 - 17230392
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||||| | | | ||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
17230460 |
ttggtggtggtcggagtttgaactccgaatcttacatatattatgcattgtctctgtcaactgagctaa |
17230392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 18877817 - 18877754
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||| || |||||||||||||| |||| |||||||||||||||| ||| |||| |
|
|
| T |
18877817 |
ttggtgctggtcggg-ttcgaaccctggaccttacatattttatgcattgtccatagcaattgag |
18877754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 20927697 - 20927645
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||| |||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
20927697 |
tttgaacctcggatcttgcatatattatgtattgtccataccaactgagctaa |
20927645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 24485745 - 24485705
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
24485745 |
accttgcatatattatgcattgtccataccaactaagctaa |
24485705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 151
Target Start/End: Original strand, 25988812 - 25988852
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattat |
151 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
25988812 |
gtggtggtcggagtttgaatcctggaccttgcatatattat |
25988852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 26377040 - 26376972
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||| ||| |||||| |||| ||||||| | |||||||||||| || |||||||||||| |
|
|
| T |
26377040 |
ttggtggtgtccggagttcgaaccccggacgttgcatataatatgcattgtccttaccaactgagctaa |
26376972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 28344628 - 28344560
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||| |||||||| | |||||||| |||| |
|
|
| T |
28344628 |
ttggtggtggtcaaggtttgaaccccaaaccttgcatatattatacattgtccctttcaactgaactaa |
28344560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 31591202 - 31591268
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatg--cattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
31591202 |
gtggtggtcggggtttgaacttcgaaccttgcata-attatgtgcattgtccataacaactgagctaa |
31591268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 31877990 - 31877938
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| || |||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
31877990 |
ggggtttgaacccctgatcttgcatatattatgcattgtccataccaagtgag |
31877938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 33369412 - 33369464
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| | || |||||||||||||| ||||| |||| |||||||| |
|
|
| T |
33369412 |
ggggtttgaaccccgaacgttgcatacattatgtattgttcataccaactgag |
33369464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 34987138 - 34987206
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| ||||||||| | |||||| ||| |||||||||| |||| | |||||||||||| |
|
|
| T |
34987138 |
ttggtagtggtcggaatttgaaccccgaaccttggatatattatgcattatccacaccaactgagctaa |
34987206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 35493963 - 35494011
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||| ||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
35493963 |
gtggtggtcggagtttgaatcccgaaccttgcatatattatgcattgtc |
35494011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 36321509 - 36321549
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
36321509 |
accttgcatatattatgcattgtccttaccaactgagctaa |
36321549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 164)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 112 - 174
Target Start/End: Complemental strand, 18684199 - 18684138
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18684199 |
tggtggtcggggtttgaaccc-ggaccttgcatacattatgcattatccatatcaactgagct |
18684138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 19416588 - 19416520
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
19416588 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
19416520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 19599214 - 19599150
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagttaaa |
19599150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 21322249 - 21322185
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||| || |||||||| |
|
|
| T |
21322249 |
ttggtggtggccggggtttgaaccctggaccttgcatacattatgcattatccttaccaactgag |
21322185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 27462426 - 27462490
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagcta |
27462490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 31038509 - 31038577
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31038509 |
ttggtggtggccggggtttgaaccccagaccttgcatacaatatgcattgtccataccaactgagctaa |
31038577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 110 - 175
Target Start/End: Original strand, 27833390 - 27833455
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |||||||||||||| || ||||||||||| |
|
|
| T |
27833390 |
ggtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttaccaactgagcta |
27833455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 18714522 - 18714454
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
18714522 |
ttggtggtgtacggggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
18714454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 111 - 171
Target Start/End: Original strand, 18773746 - 18773806
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18773746 |
gtggtggtcggggtttgaaccccggaccttacatattttatgcattgtccatatcaactga |
18773806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 10244788 - 10244733
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
10244733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 108 - 175
Target Start/End: Original strand, 45046202 - 45046269
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||||| | |||||||||| |||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
45046202 |
ttggtggtggtcagagtttgaaccccggaccttgcatatattatgtactgtccatatcaactgagcta |
45046269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 5579765 - 5579699
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| ||||| || |||||||||||| |
|
|
| T |
5579765 |
ggtggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaa |
5579699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 28230850 - 28230784
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
28230850 |
gtggtggtcggtgtttgaaccccggaccttgcatacatcatgcattgtccattacaactgagttaaa |
28230784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 107 - 176
Target Start/End: Complemental strand, 3671899 - 3671830
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| |||||||||||| |||| | |||||||||| |
|
|
| T |
3671899 |
attggtggtggtcggggtttgaactccagaccttgcatatattatgcattgttcataccgactgagctaa |
3671830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 3830139 - 3830074
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
3830139 |
gtggtggctggggtttgaaccctggaccttgcatatattatgcattgtccctacaaactgagctaa |
3830074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 8227423 - 8227354
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| | || ||||||||||| || |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
8227423 |
ttggtggtggtcgagattcgaaccctggactttacatatattatgcattgtccttatcaactgagctaaa |
8227354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 18023750 - 18023701
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18023750 |
gtggtggtcggagtttgaaccctggaccttgcatatattatgcattgtcc |
18023701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 38374189 - 38374246
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||| ||| |||||||| |
|
|
| T |
38374189 |
cggggtttgaaccctggaccttgcatatactatgcattgtccataccaattgagctaa |
38374246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 6023383 - 6023315
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| ||| |||||||||| | |||||||||||| |
|
|
| T |
6023383 |
ttggtggtggtcggggtttgaaccccgaaccttgcatattttaagcattgtccaaaccaactgagctaa |
6023315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 7670508 - 7670440
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||| |||||||||||| || | |||||||||||| |
|
|
| T |
7670508 |
ttggtagtggtcgaggtttgaaccccggaccttgcatatattatgcattgttcaaaccaactgagctaa |
7670440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 39801780 - 39801712
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||| | |||| ||| |||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
39801780 |
ttggtggtggttggggttcgtaccccggatcttgcatatattatgcattgtccataccaactgagctaa |
39801712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 48629056 - 48629120
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgtccctaacaactgaactaa |
48629120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 112 - 171
Target Start/End: Complemental strand, 7735600 - 7735541
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
7735600 |
tggtggtcgggctttgaaccctagaccttgcatattttatgcattgtccataccaactga |
7735541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 34448603 - 34448661
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| ||||||||||||||| | |||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcattgtccaaaccaactgag |
34448661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 35142138 - 35142204
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35142138 |
ggtggtggtcggggttcgaacctcaaactttgcatatattatgcattgtccatatcaactgagctaa |
35142204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 46987158 - 46987092
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
46987158 |
ggtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
46987092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 47607900 - 47607966
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| |||||| | ||||| || ||||||||||||| |
|
|
| T |
47607900 |
gtggtggccggagtttgaaccctggaccttgcatatattatgtaatgtccctaccaactgagctaaa |
47607966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 156
Target Start/End: Complemental strand, 10242551 - 10242506
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10242551 |
gtggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 21105674 - 21105609
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
21105674 |
gtggtggtcggggttcgaacctcgaaccttgcatatattatgcattttccataccaactgagctaa |
21105609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 30006082 - 30006147
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
30006082 |
gtggtggttggggtttgaaccccaaaccttgcatacattatgcattattcataccaactgagctaa |
30006147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 42336140 - 42336075
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| | || |||||| ||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
42336140 |
tggtggtcgagattcgaaccccggaccttgcatgtattatgcattgtccttatcaactgagctaaa |
42336075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 42829224 - 42829285
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||| |||||||||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42829224 |
gtggtggccggagtttgaaccccggagcttgcatatattatgcattgtccctatcaactgag |
42829285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 119 - 163
Target Start/End: Complemental strand, 6781870 - 6781826
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6781870 |
cggggtttgaaccctggaccttgcatattttatgcattgtccata |
6781826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 10026068 - 10026004
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||| | |||||||| |
|
|
| T |
10026068 |
ttggtggtggtcggggtttgaaccccataccttgcatattttatgcattgtccaaaccaactgag |
10026004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 19626512 - 19626576
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||| ||| |||||||||| |||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
19626512 |
ttggtagtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgag |
19626576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 25288735 - 25288671
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||| ||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25288735 |
gtggtggctgggatttgaactccggaccttgcatatcttatgcattgtccatatcaactgagcta |
25288671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 33473508 - 33473560
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
33473508 |
ttggtggtggccagggttggaaccctggaccttgcatatattatgcattgtcc |
33473560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 41029342 - 41029278
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| || |||||| |||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacattgtccttaccaactgagctaa |
41029278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 43346551 - 43346619
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||| ||| ||| ||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
43346551 |
ttggtggtggatggggtttgatccccggatcttacatatattatgcattgtccataccaactgagctaa |
43346619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 46371055 - 46370987
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| ||| |||||||||| |||| ||||| ||| |||| |
|
|
| T |
46371055 |
ttggtggtggtcggagtttgaaccccggaccttggatatattatgcattatccaaatcaattgaactaa |
46370987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 46737859 - 46737791
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| ||| |||||||||| |||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
46737859 |
ttggtagtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaacaaactgagctaa |
46737791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 47342421 - 47342485
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||||||| |||||||| | |||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
47342421 |
ttggtagtggtcggagtttgaactccggaccttgcatatattatgcattgtccaaaccaactgag |
47342485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 163
Target Start/End: Complemental strand, 8084501 - 8084446
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
8084501 |
ttggtggtggccggggttcgaaccccggaccttgcatattttatgcattgtccata |
8084446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 167
Target Start/End: Original strand, 37495909 - 37495964
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaa |
167 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||||||||| || ||||||| |
|
|
| T |
37495909 |
tggtggtcgggatttgaaccttggaccttgcatatattatgcattatcaatatcaa |
37495964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 41250036 - 41250103
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| ||||| |||||| | |||||||||||||||| |
|
|
| T |
41250036 |
ggtggtgttcggggcttgaacctcggaccttgcatatattatacattgttcttatcaactgagctaaa |
41250103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 43539104 - 43539159
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||||||| | ||||||||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgttcctatcaactgagctaa |
43539159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 45425527 - 45425452
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaagtgaca |
183 |
Q |
| |
|
|||||||||| |||| || |||||| | |||||||||| ||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
45425527 |
ttggtggtggccgggattcgaaccccgaaccttgcatatattatgcattgtctttatcaactgagttaaactgaca |
45425452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 47155092 - 47155143
Alignment:
| Q |
109 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
47155092 |
tggtggtgtccggggttcgaaccctggaccttgcatatattatgcattgtcc |
47155143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 145592 - 145550
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatta |
150 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
145592 |
ttggtggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 11893208 - 11893150
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatca |
166 |
Q |
| |
|
|||||||||||| |||||| |||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
11893208 |
ttggtggtggtcagggtttaaaccgtagaccttgcatattttatgcattgtccatatca |
11893150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 16577850 - 16577916
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||| |||||| ||||||| || ||||||||||||| |
|
|
| T |
16577850 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaaa |
16577916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 16587812 - 16587746
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||| |||||| ||||||| || ||||||||||||| |
|
|
| T |
16587812 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaaa |
16587746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 21554924 - 21554982
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| ||||| ||| || ||||| |
|
|
| T |
21554924 |
gtggtggtcggggtttgaatcctggaccttgcatatattaagcattatccctaccaact |
21554982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 115 - 177
Target Start/End: Original strand, 23198743 - 23198805
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||||| |||| |||||||| |||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcatattttatgcattgttcataccaactgagttaaa |
23198805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 30857319 - 30857253
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
30857319 |
gtggtggttggggtttgaactcaaaaccttgcatatattatgcattgtccataccaactaagctaaa |
30857253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 39926539 - 39926593
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| | || ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39926539 |
ggtttgaaccccgaacattgcatatattatgcattgtccttatcaactgagctaa |
39926593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 42095944 - 42095998
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| |||||||| |||| |||||| |
|
|
| T |
42095944 |
ggtttgaaccccggaccttgcatatattatgcatggtccatataaactaagctaa |
42095998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 177
Target Start/End: Original strand, 44558788 - 44558830
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
44558788 |
gaccttgcatatattatgcattgtccataccaactgagctaaa |
44558830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 580916 - 580981
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| |||| | ||| |||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
580916 |
gtggtggtcggggttcgaacgccggatcttgcatattttatgcattgtccataccaaccgagctaa |
580981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 3584278 - 3584217
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||||||||||||| | | |||||||||| |||||||||||||| || ||||| |
|
|
| T |
3584278 |
ttggtggtggtcggggtttgaatctcgtaccttgcatatattatgcattgtccttaccaact |
3584217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 3672539 - 3672608
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| || ||||||||||| | |||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
3672539 |
ttggtggtgtccgaggtttgaaccccatatcttgcatatattatgtattgtccatatcaactgagctaaa |
3672608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 5458061 - 5458126
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||| |||||||| || ||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
5458061 |
gtggtgttcgaggtttgaatcccagaccttgcatatattatgcattgttcttatcaactgagctaa |
5458126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 12320250 - 12320189
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
12320250 |
tggtcggggtttgaacttgagaccttgcataaattatgcattgtccctaccaactgagctaa |
12320189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 20243330 - 20243261
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20243330 |
ttggtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaa |
20243261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 21580883 - 21580826
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||| | ||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
21580883 |
tggtcggggtttgaaccatataccttacatatattatgcattgtccatatcaattgag |
21580826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 26717918 - 26717963
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| |||||||||| |
|
|
| T |
26717918 |
gtggtggtcagagtttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 29237558 - 29237611
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| | || ||||||||||| |
|
|
| T |
29237558 |
ggttcgaaccctggaccttgcatatattatgcattgttcttaccaactgagcta |
29237611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 29726867 - 29726810
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||| |||||| ||| ||||||||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcatatattatacattgttcatgtcaactgag |
29726810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 30793036 - 30793097
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| || ||||||| |||| |||||| | ||||||||||||||| |||||||| |
|
|
| T |
30793036 |
gtggtggtcgggattcgaaccctagaccatgcatatactatgcattgtccataccaactgag |
30793097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 32315294 - 32315233
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||| |||||| | ||||| ||||||||||| |
|
|
| T |
32315294 |
gtggtggtcagggttcgaaccctgaaccttgcatatattatgtaatgtccttatcaactgag |
32315233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 33610915 - 33610980
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||| ||| |||| | |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
33610915 |
gtggtggccggtgttcgaactccggaccttgcatatattatgcattgtccgtaacaactgagctaa |
33610980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 35222986 - 35222929
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||||| |||||||||| ||||| |
|
|
| T |
35222986 |
ggggtttgaaccccagaccttgcatatatcatgcattgtccctatcaactgacctaaa |
35222929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 37624614 - 37624553
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||| || |||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcattgtccataccaactgag |
37624553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 39280820 - 39280873
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| | || |||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcattgttcttaccaactgagctaa |
39280873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 45088946 - 45088886
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||||||||| |||| ||| |||| |
|
|
| T |
45088946 |
gtggtggtcggggtttgaaccccg-accttgcatatattatgcattgttcataccaattgag |
45088886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 48527261 - 48527200
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||| || |||| | |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
48527261 |
gtggtggccgggattcgaactccggaccttgcatatattatgcattgtccttatcaactgag |
48527200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 5526795 - 5526731
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| | ||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
5526795 |
tggtggtcggggtttgaaccccaaatcttatatatattatgcattgtccataccaactgagctaa |
5526731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 6579692 - 6579628
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |||| ||||||||||| ||| |||| |
|
|
| T |
6579692 |
ttggtggtggtcggggtttgaaccttacaccttgcatattttatacattgtccataccaattgag |
6579628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 7872735 - 7872803
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | ||||| |||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
7872735 |
ttggtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaa |
7872803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 7994871 - 7994935
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |||||| |||||| || |||||||| |
|
|
| T |
7994871 |
ttggtggtggtcggggtttgaaccccagaccttacatatattatgttttgtccctaccaactgag |
7994935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 9522982 - 9522918
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| |||||| |||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcattgttcataccaactgagctaa |
9522918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 10327023 - 10326960
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||| |||||||||||| || | |||||||||||| |
|
|
| T |
10327023 |
tggtggccgaggtttgaacc-tggaccttgcatatattatgcattgttcacaccaactgagctaa |
10326960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 167
Target Start/End: Complemental strand, 12167478 - 12167422
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaa |
167 |
Q |
| |
|
|||||||| |||||||||| || |||||||| ||| |||||||||||| |||||||| |
|
|
| T |
12167478 |
gtggtggttggggtttgaatcccggaccttgaatatattatgcattgttcatatcaa |
12167422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 14786193 - 14786129
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
14786193 |
tggtggtcgggatttgaatcccagaacttgcatacattaagcattgttcataccaactgagctaa |
14786129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 17883958 - 17883894
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||| ||||| |||| |||||||||| |||||||| |
|
|
| T |
17883958 |
tggtggccggagtttgaacccaagaccttgcatatattatacattatccatatcaagtgagctaa |
17883894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 18505649 - 18505712
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
18505649 |
tggtagtcggggtttgaaccc-ggatcttgcatattttatgcattgtccctaccaactgagctaa |
18505712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 21174433 - 21174365
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||| |||| | ||| |||||||| || |||||||||||| |
|
|
| T |
21174433 |
ttggtggtggccggggtttgaaccccggaactttcatatagtattcattgtccctaccaactgagctaa |
21174365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 30033888 - 30033820
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||| | |||||||||||| | || |||||||||||| |
|
|
| T |
30033888 |
ttggtggtggtcgggattgaaaccctagaccttgcaaatattatgcattgttcttaccaactgagctaa |
30033820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 36341052 - 36341116
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| ||| ||||||||||| |||| |||||||| |
|
|
| T |
36341052 |
ttggtggtggtcgaggtttgaactccggaccttgtatattttatgcattgttcataccaactgag |
36341116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 40187623 - 40187687
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||| |||||||||||||| || |||||||| |
|
|
| T |
40187623 |
ttggtggtgttcggggtttgaaccgcagaccttacatatattatgcattgtccctaccaactgag |
40187687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 40752830 - 40752894
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| |||||| |||| ||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatgtattgtccatactaactgagctaa |
40752894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 41237911 - 41237975
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||||| |||| | |||||||||| |||||||| |
|
|
| T |
41237911 |
ttggtggtggtcgaggtttgaacctcgaaccttgcatatattacgtattgtccataccaactgag |
41237975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 177
Target Start/End: Original strand, 43680990 - 43681046
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
43680990 |
gggtttgaaccctagaccttgcatattttatgcattgtcccaatcaactgagttaaa |
43681046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 8290459 - 8290518
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
8290459 |
gtggtggtcgggattcgaaccccggaccttgcatattattatgcattgtccataccaact |
8290518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 159
Target Start/End: Original strand, 20085758 - 20085797
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcattgtc |
20085797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 172
Target Start/End: Original strand, 27993025 - 27993080
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
27993025 |
gtcgaggtttgaaccctagaccttgcatattttatgcattgttcataccaactgag |
27993080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 177
Target Start/End: Complemental strand, 30623040 - 30622977
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||| ||||||| ||||| |||| |||| |
|
|
| T |
30623040 |
gtggtcggggtttgaaccatagaccttgcatatattatgtattgtcccaatcaattgagttaaa |
30622977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 171
Target Start/End: Complemental strand, 37235385 - 37235322
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
37235385 |
ttggtggtggtcggggttcaaacttcagaccttgcatatatcatgcattgtccatatcaactga |
37235322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 109 - 177
Target Start/End: Original strand, 394348 - 394413
Alignment:
| Q |
109 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| | | ||| |||||| |||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
394348 |
tggtggtggccagtgttcgaaccccggaccttgcatatattatgca---tccatatcaactgagctaaa |
394413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 173
Target Start/End: Complemental strand, 2618734 - 2618688
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
2618734 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
2618688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 3953500 - 3953447
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| | |||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
3953500 |
ggtttgaaccc-gaaccttgcatatattatgcattgtccataccgactgagctaa |
3953447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 4406699 - 4406769
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||| |||| | ||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
4406699 |
ttggtggtgtccggggttcgaactcgcgaccttgcatatatttatgcattgtctatatcaactgagctaaa |
4406769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 5041398 - 5041352
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatattatgcattgtccataccaact |
5041352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 7908660 - 7908598
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||| | ||||| |||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
7908660 |
tggtcggggttcgaaccccgaaccttacatattttatgcattgtccataccaactgaactaaa |
7908598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 8615071 - 8615029
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
8615071 |
ggaccttgcatatattatgcattgtccttaccaactgagctaa |
8615029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 15433460 - 15433514
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
15433460 |
ggtttgaacctcagaccttgcatatattattaattgtccatatcaactgagctaa |
15433514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 20521044 - 20521086
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
20521044 |
ggaccttgcatacattatggattgtccttaccaactgagctaa |
20521086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 21597748 - 21597690
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||| ||| ||| | ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
21597748 |
gtggtcagggtttaaactctgaaacttacatatattatgcattgtccatatcaactgag |
21597690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 25246830 - 25246776
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| | | |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
25246830 |
gtttgaacccagaatcttgcatatattatgcattgtctttatcaactgagctaaa |
25246776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 25602985 - 25602923
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||| ||||| || ||||||||| |||||||||||| | |||||| |||||||| |
|
|
| T |
25602985 |
gtggttggggtttcaaccccgggccttgcatatattatgcattgttcttatcaattgagctaa |
25602923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 29053111 - 29053049
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||| |||| ||||| |||| | |||||||||||| |
|
|
| T |
29053111 |
gtggtcggagtttgaaccccggaccttggatatattaagcattatccaaaccaactgagctaa |
29053049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 41527608 - 41527566
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
41527608 |
ggaccttgcatatattatgcattgtccataccaactaagctaa |
41527566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 42753529 - 42753583
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||| | ||||||||||||| |
|
|
| T |
42753529 |
gtttgaaccccggaccttgcatatattatgcactgtcccttccaactgagctaaa |
42753583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 42817680 - 42817615
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
42817680 |
gtggtggccggggtttgaaccccataccttgcatat-ttatgcattgtccttaccaactgagctaaa |
42817615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 147 - 177
Target Start/End: Complemental strand, 45200228 - 45200198
Alignment:
| Q |
147 |
attatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45200228 |
attatgcattgtccatatcaactgagctaaa |
45200198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 46207827 - 46207766
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||| |||| ||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
46207827 |
gtggttggggtttgaaccc-ggacattgcatattttatgcattgttcataccaactgagctaa |
46207766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 173
Target Start/End: Original strand, 1311817 - 1311854
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1311817 |
accttgcatattttatgcattgtccatatcaactgagc |
1311854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 2512383 - 2512312
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatg---cattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||| |||||| |||||| |||| |||||||||||| |
|
|
| T |
2512383 |
ttggtggtggccggggtttgaacctcgtaccttgcatatattatgctacattgttcataccaactgagctaa |
2512312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 7388029 - 7388078
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||||||||||| || | ||||| |||| |||||||||||||| |
|
|
| T |
7388029 |
gtggtggtcggggtttgaatcccgaaccttacatatattatgcattgtcc |
7388078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 10236892 - 10236961
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||| ||||| | ||||||||||||||||||||||| | || |||||||| |||| |
|
|
| T |
10236892 |
ttggtggtgtccggggttcgaacctcgaaccttgcatacattatgcattgttcttaccaactgagttaaa |
10236961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 14046601 - 14046662
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||| | | |||||||| |||||||||| ||||| |||||||| |
|
|
| T |
14046601 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccataccaactgag |
14046662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 14356631 - 14356692
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||| | | |||||||| |||||||||| ||||| |||||||| |
|
|
| T |
14356631 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccataccaactgag |
14356692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 20135148 - 20135217
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcataca-ttatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||| | |||| ||||||| ||||||||||||||| |
|
|
| T |
20135148 |
ttggtggtgtccggggttcgaacccgggaccttgcatatatttatacattgtctttatcaactgagctaa |
20135217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 128 - 177
Target Start/End: Complemental strand, 20205876 - 20205827
Alignment:
| Q |
128 |
aaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||| || |||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
20205876 |
aaccccggactttacatatattatgcattgtccataccaactgagctaaa |
20205827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 20763225 - 20763176
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
20763225 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20763176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 21050236 - 21050277
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
21050236 |
gaccttgcatatattatgcattgtccttaccaactgagctaa |
21050277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 21099761 - 21099829
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| || ||||| |||| | |||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
21099761 |
ttggtggtggccgcggtttaaacc-tcgaccttatatatattatgcattgtccataccaactgagctaaa |
21099829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 21286413 - 21286356
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| ||||||||||| |||||| |||||||||| ||| |||||||| |
|
|
| T |
21286413 |
cggggttggaaccccagaccttgcatatattatgtattgtccataccaattgagctaa |
21286356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 21327528 - 21327593
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatta-tgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| |||| |||||||| | ||||||||||| |
|
|
| T |
21327528 |
ttggtggtggtcggagtttgaaccccaaaccttgcatatattattgcattgttcctatcaactgag |
21327593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 22555700 - 22555631
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| |||||||| |||| |||||| |||||| ||||||| ||||| || ||||||||||||| |
|
|
| T |
22555700 |
ttggtggtgttcggggttcgaactttggaccgtgcatattttatgcaatgtccttaccaactgagctaaa |
22555631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 22777373 - 22777410
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
22777373 |
gaccttgcatatattatgcattgtccttatcaactgag |
22777410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 23413060 - 23413097
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
23413060 |
gaccttgcatatattatgcattgtccataccaactgag |
23413097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 29488791 - 29488742
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
29488791 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
29488742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 33232387 - 33232436
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
33232387 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
33232436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 33781471 - 33781532
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||||| | |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33781471 |
gtggtggtcggagtttgaaatcgataccttgcataaattatgcattgtccctatcaactgag |
33781532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 34284529 - 34284578
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
34284529 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
34284578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 171
Target Start/End: Original strand, 36343541 - 36343586
Alignment:
| Q |
127 |
gaaccctggaccttgcatac-attatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36343541 |
gaaccctggaccttgcatattattatgcattgtccataccaactga |
36343586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 36769225 - 36769156
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
36769225 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaa |
36769156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 37307865 - 37307930
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| ||||| ||||||| ||| |||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
37307865 |
tggtgctcgggatttgaacatcggatcttgcatatattatgcattgttcctatcaactgagctaaa |
37307930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 37516796 - 37516853
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||||||||| | |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
37516796 |
tggtcgaggtttgaactccggaccttgcatatgttatgcattgtccatactaactgag |
37516853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 37930115 - 37930054
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| || | | | |||||| |||||||||||||| || |||||||| |
|
|
| T |
37930115 |
gtggtggtcggggtttgaatcccgaatcctgcatatattatgcattgtccttaccaactgag |
37930054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 39043810 - 39043765
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
39043810 |
gaaccccggacctagcatatattatgcattgtccataccaactgag |
39043765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 40036096 - 40036161
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
40036096 |
tggtgttcggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaa |
40036161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 43579051 - 43579108
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| |||| |||||| |||||||||||||| || |||||||||||| |
|
|
| T |
43579051 |
cggggttcgaacccaggactttgcatgtattatgcattgtccctaccaactgagctaa |
43579108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 43629065 - 43629134
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||| ||| || || ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
43629065 |
ttggtggtggatggggttagaatccaagatcttgcatacattatgtattgtccatactaactgagctaaa |
43629134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 176
Target Start/End: Complemental strand, 45051748 - 45051703
Alignment:
| Q |
131 |
cctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||| |||||||||||||||| |||| |||||||||||| |
|
|
| T |
45051748 |
cctggatcttgtatacattatgcattgttcataccaactgagctaa |
45051703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 4905346 - 4905286
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||||||| | | |||||||||| |||||||||||||| | |||||||| |
|
|
| T |
4905346 |
tggtggccggggtttgaactccgaaccttgcatattttatgcattgtccacaacaactgag |
4905286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 172
Target Start/End: Original strand, 5317303 - 5317339
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5317303 |
accttgcatatattatgcattttccatatcaactgag |
5317339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 21136900 - 21136841
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| |||||||| | |||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
21136900 |
tggtggtcgggatttgaacc-tcaaccttgcatatattatacattgtccataccaactgag |
21136841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 172
Target Start/End: Original strand, 22991406 - 22991442
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
22991406 |
accttgcatatattatgcattgtccataccaactgag |
22991442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 156
Target Start/End: Original strand, 26529682 - 26529726
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 26920701 - 26920769
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| | || ||||||||||| |||||| || |||||||||||| |
|
|
| T |
26920701 |
ttggtggtggtcggggtttgaaccccaaaatttacatacattatgtattgtctttaccaactgagctaa |
26920769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 172
Target Start/End: Complemental strand, 27263387 - 27263351
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
27263387 |
accttgcatatattatgcattgtccataccaactgag |
27263351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 172
Target Start/End: Complemental strand, 27270281 - 27270245
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
27270281 |
accttgcatatattatgcattgtccataccaactgag |
27270245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 28736623 - 28736671
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
28736623 |
gtggtggttggggtttgaacctcggaccttgcatatatcatgcattgtc |
28736671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 29926395 - 29926447
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| | | ||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
29926395 |
ttggtggtggccagagtttgaaccctggacattgcatatatcatgcattgtcc |
29926447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 29986667 - 29986627
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatg |
152 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
29986667 |
tggtggacggggtttgaaccctggaccttgcgtatattatg |
29986627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 34568348 - 34568388
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
34568348 |
accttgcatatattatgcattatccttatcaactgagctaa |
34568388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 36428221 - 36428158
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||||||||||| |||||| | |||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
36428221 |
ttggtgttggtcggggttcgaaccccg-accttgcatattttatacattgtccataccaactgag |
36428158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 177
Target Start/End: Original strand, 38326848 - 38326912
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||||||| |||| ||||||||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
38326848 |
ggtggccggggtttcaacctcggaccttgcatgtattatgttttgtccataccaactgagctaaa |
38326912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 42227792 - 42227844
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||| |||||||||||||| |
|
|
| T |
42227792 |
ttggtggtggtcggagtttgaacctcgaaccttacatatattatgcattgtcc |
42227844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 43139339 - 43139271
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||||||| |||||||| ||| ||||| |||||||| |
|
|
| T |
43139339 |
ttggtagtggtcggggtttgaaccccgtaccttgcatattttatgcatagtctcaatcaagtgagctaa |
43139271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 47342723 - 47342683
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
47342723 |
accttgcatattttatgcattgtccataccaactgagctaa |
47342683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 49063745 - 49063813
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| |||| ||| | ||||||||||| |||||||||||||| || || ||||||||| |
|
|
| T |
49063745 |
ttggtggtggtcgaggttcgaatctcggaccttgcatttattatgcattgtccgtaccatctgagctaa |
49063813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 168)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 34521177 - 34521246
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
34521177 |
ttggtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaaa |
34521246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 17139504 - 17139572
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
17139504 |
ttggtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaa |
17139572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 110 - 172
Target Start/End: Complemental strand, 32962635 - 32962573
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
32962635 |
ggtggtggtcggggtttgaaccctggaccttgcatattttatgcattgttcataccaactgag |
32962573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 8269358 - 8269423
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
8269358 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaa |
8269423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 40411743 - 40411808
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||| || ||| |||||||| |
|
|
| T |
40411743 |
gtggtggtcggggtttgaaccctggaccttacatacattatgtattgtccttaccaattgagctaa |
40411808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 45139996 - 45140061
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
45139996 |
gtggtggccggggtttaaactctggaccttgcatatattatgcattgtccataccaactgagctaa |
45140061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 5907873 - 5907805
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
5907873 |
ttggtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtccttgccaactgagctaa |
5907805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 18166676 - 18166608
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| |||| ||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
18166676 |
ttggtagtggtcggggtttgaaccccggactttgcatatattatgcattgtctataccaactgagctaa |
18166608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 27533317 - 27533249
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
27533317 |
ttggtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctaccaactgatctaa |
27533249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 42045359 - 42045427
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
42045359 |
ttggtggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaa |
42045427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 50638903 - 50638971
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
50638903 |
ttggtggtggccgggattcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaa |
50638971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 17917128 - 17917194
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||| || | ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17917128 |
gtggtggtcggggtttgaatcccgaaccttacatattttatgcattgtccatatcaactgagctaaa |
17917194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 26755676 - 26755622
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatataatgcattgtccatatcaactgagctaa |
26755622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 44641598 - 44641532
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| | || ||||||||| || ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44641598 |
gtggtggccaggatttgaaccccgggccttgcatatattatgcattgtccatatcaactgagctaaa |
44641532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 1794667 - 1794602
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
1794667 |
gtggtggtcgaggtttgaaccccggatcttgcatatattatgcattgtccatactaactgagctaa |
1794602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 23405345 - 23405406
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
23405345 |
ttggtggtggtcgggattcgaaccctggaccttgcatatattatgcattgtccttaacaact |
23405406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 25533036 - 25532979
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
25533036 |
cggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgaactaa |
25532979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 39252247 - 39252312
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| || |||||||||||||||||| |||| |||||| |||||| |||||||||||||||| |
|
|
| T |
39252247 |
gtggtggttggagtttgaaccctggaccttacatatattatgtattgtcgatatcaactgagctaa |
39252312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 26803450 - 26803506
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcattgtccataccaactgagctaa |
26803506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 32944810 - 32944742
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||| |||||| ||| ||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
32944810 |
ttggtggtggtcggggttcgaaccccagacgttgcatatattatgcattgtccataccaactaagctaa |
32944742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 42888649 - 42888581
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
42888649 |
ttggtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
42888581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 17284012 - 17283957
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
17284012 |
gggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaa |
17283957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 27449445 - 27449500
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| | |||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27449445 |
gggtttgaaccctgaatcttgcatatattatgcattgtccatattaactgagctaa |
27449500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 167
Target Start/End: Original strand, 36467012 - 36467071
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaa |
167 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
36467012 |
ttggtggtggtcgggatttgaaccttataccttgcatatattatgcattgtccatatcaa |
36467071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 2994826 - 2994768
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattatacattgtccatacgaactgag |
2994768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 32561041 - 32560983
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacattgtccataccaactgag |
32560983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 44243944 - 44243878
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||| |||||||||||| | || ||||||||||||| |
|
|
| T |
44243944 |
gtggtggttggggtttgaactctggaccttacatatattatgcattgttcctaccaactgagctaaa |
44243878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 1091250 - 1091189
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| | |||||||||| | |||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
1091250 |
gtggtggtcagagtttgaaccccgaaccttgcatacattatgcattgtctataccaactgag |
1091189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 7158847 - 7158778
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||| | ||| | |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7158847 |
ttggtggtggtcggggctcaaactccggaccttgcatattttatgcattgtccatatcaactgggctaaa |
7158778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 8736506 - 8736449
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaac |
168 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaac |
8736449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 114 - 171
Target Start/End: Original strand, 12268977 - 12269034
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||| | || ||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgttcctaccaactga |
12269034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 15854078 - 15854143
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| || |||||||| |||||| |||||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
15854078 |
gtggtggccgaggtttgaatcctggatcttgcatatattatgcatcgtccataccaactgagctaa |
15854143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 16033440 - 16033501
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||| |||||||||| ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
16033501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 16967184 - 16967249
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||| ||||||||| | |||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16967184 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcattgtccatatcaactaagctaa |
16967249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 40227900 - 40227835
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
40227900 |
gtggtggtcggggttcgaaccccagaccttgtatattttatgcattgtccataccaactgagctaa |
40227835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 52043347 - 52043278
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| ||||||||| | || ||||||| ||||||||| |||||| ||||||||||||| |
|
|
| T |
52043347 |
ttggtggtggtcgggatttgaaccccgaacattgcatattttatgcattatccataccaactgagctaaa |
52043278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 25086541 - 25086489
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
25086541 |
tttgaaccctagaccttgcatattttatgcattgtccataccaactgagctaa |
25086489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 29739411 - 29739343
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| | || ||||||||||| |||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
29739411 |
ttggtggtagccgaggtttgaaccccggaccttgcatattttatgcattgtccttaccaactgagctaa |
29739343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 32950748 - 32950812
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
32950748 |
ttggtggtggtcgaggtttgaactccggaccttgcatatattatgcattgtttataccaactgag |
32950812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 38448853 - 38448921
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||| || |||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
38448853 |
ttggtggtgtccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
38448921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 41769802 - 41769870
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||| ||| |||||||||| |||| | |||||||||||| |
|
|
| T |
41769802 |
ttggtagtggtcggagtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaa |
41769870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 175
Target Start/End: Complemental strand, 51503754 - 51503686
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||| ||| |||||||||||||| || ||||||||||| |
|
|
| T |
51503754 |
attggtggtggccggcgttcgaaccctagaccttggatatattatgcattgtccctaccaactgagcta |
51503686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 3481633 - 3481566
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||||| |||||| || |||||||||||| |
|
|
| T |
3481633 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaa |
3481566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 13401666 - 13401603
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||| ||||||||||||| |||||||||| |||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcattgtctctatcaactgaactaa |
13401603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 175
Target Start/End: Original strand, 13615603 - 13615666
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
13615603 |
tggtgttcggggttcgaaccttggaccttgcatgtattatgcattgtccttaccaactgagcta |
13615666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 24752636 - 24752703
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
24752636 |
ggtggtggccggggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaa |
24752703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 37045132 - 37045199
Alignment:
| Q |
107 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||||| | || |||||||||| |
|
|
| T |
37045132 |
attggtggtgtctggggttcgaaccctggaccttgcatatattatgcattgttcctaccaactgagct |
37045199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 50040417 - 50040362
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
50040417 |
gggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaa |
50040362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Original strand, 1887559 - 1887605
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaa |
167 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
1887559 |
gggtttgaaccctgaactttgcatacattatgcattgtccctatcaa |
1887605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 2613790 - 2613728
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||| | ||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
2613790 |
gtggtcggggttcgaaccccgaaccttacatattttatgcattgtccataccaactgagctaa |
2613728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 3509954 - 3509996
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3509954 |
ggaccttgcatatattatgcattgtccataccaactgagctaa |
3509996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 3693789 - 3693851
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||| |||||| |||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
3693789 |
gtggtcggggtttgaacctcagaccttacatatattatgctttgtctatatcaactgagctaa |
3693851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 8210375 - 8210433
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| ||| |||||||||||||| || ||||| |
|
|
| T |
8210375 |
gtggtggccggggttcgaaccctggaccttgtatatattatgcattgtccttaccaact |
8210433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 29233964 - 29234030
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
29233964 |
gtggtggttggggttcgaaccccagaccttgcatattttatgcattgtctataccaactgagctaaa |
29234030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 115 - 169
Target Start/End: Complemental strand, 29506894 - 29506840
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||| |||||| ||| ||||| |
|
|
| T |
29506894 |
tggtcggggttcgaaccctggaccttgcatatattatgtattgtctataccaact |
29506840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 40734995 - 40735061
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| |||||||||||| | ||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
40734995 |
gtggtggtcagggtttgaaccccgaaccttacatattttatgcattgtccatactaactgagctaaa |
40735061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 41763148 - 41763210
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| ||||||||| ||| || |||||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcattatccctaccaactgagctaa |
41763210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 52441500 - 52441566
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||| ||| | |||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
52441500 |
ggtggtggccggggttcaaacgccggaccttgcatatattatgcattgtctataccaactgagctaa |
52441566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 136 - 177
Target Start/End: Original strand, 3393583 - 3393624
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
3393583 |
accttgcatatattatgcattgttcatatcaactgagctaaa |
3393624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 7732496 - 7732427
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||||||| ||||||| || ||| |||| ||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
7732496 |
ttggtagtggtcggagtttgaatcccggatcttggatatattatgcattatccaaatcaactgagctaaa |
7732427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 10293007 - 10292946
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||| ||||| | |||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
10293007 |
gtggtggtcggggtttaaaccccgtcccttacatatattatgcattgtccctatcaactgag |
10292946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 10356173 - 10356234
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||| ||| |||||| ||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
10356173 |
gtggtggccggagttcgaaccccggaccgtgcatatattatgcattgtccataccaactgag |
10356234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 15549227 - 15549292
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
15549227 |
tggtggtcggggattgaactttagaccttgcatattattatgcattgtctatatcaactgagctaa |
15549292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 16307720 - 16307671
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
16307720 |
gtggtggtcggggtttgatccccagaccttgcatatattatgcattgtcc |
16307671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 17669716 - 17669655
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||| |||||||||| | |||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
17669716 |
gtggtggccggagtttgaaccccgaaccttgcatatattatacattgtccctatcaactgag |
17669655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 28832161 - 28832222
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
28832161 |
gtggtggtcgggatttgaacctcagaccttgcatatattatgcattgttcataccaactgag |
28832222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 33153870 - 33153931
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||| |||||||||||||| || |||||||| |
|
|
| T |
33153870 |
gtggtgttcggggtttgaacctcggaccttacatatattatgcattgtccctaccaactgag |
33153931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 35011464 - 35011399
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||| |||||||| || |||||||||| |||||||||||||| | ||||| ||||||| |
|
|
| T |
35011464 |
gtggtgttcgggttttgaaccttgaaccttgcatatattatgcattgtccttgtcaaccgagctaa |
35011399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 41973326 - 41973277
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtcc |
41973277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 48681923 - 48681988
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||| | | | |||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
48681923 |
gtggtggtcggagtttgagctccgaaccttgcatatattatgcattgttcataccaactgagctaa |
48681988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 3777792 - 3777728
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| |||||||||| | |||||| ||| ||||| |||| ||||||||||||||| |
|
|
| T |
3777792 |
ttggtggtggtcgaggtttgaacctcgaaccttgtatatattatacattatccatatcaactgag |
3777728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 8253785 - 8253745
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
8253785 |
accttgcatatattatgcattgtccataccaactgagctaa |
8253745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 172
Target Start/End: Original strand, 8266201 - 8266237
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8266201 |
accttgcatacattatgcattgtccataccaactgag |
8266237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 9005753 - 9005689
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| |||| |||||| ||||||| || |||||||| |
|
|
| T |
9005753 |
ttggtggtggttggggtttgaacccatgaccttccatatattatgtattgtccctaccaactgag |
9005689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 9929230 - 9929270
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
9929230 |
ggggttttaaccctggaccttgcatatattatgcattgtcc |
9929270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 12214062 - 12213999
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| |||||| ||||| | ||||||||||||||| |
|
|
| T |
12214062 |
tggtggtcggggtt-gaaccccagaccttgcatatattatgtattgttcctatcaactgagctaa |
12213999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 19620634 - 19620582
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
19620634 |
tttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaa |
19620582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 21400011 - 21400078
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || ||||| |||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
21400011 |
ttggtggtg-tcagggttcgaacccaagaccttgcatatattatgcattgtccctaccaactgagctaa |
21400078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 21638187 - 21638119
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||| || ||||||||||| || ||| |||||||| |
|
|
| T |
21638187 |
ttggtggtgtccggggttcgaaccccggaccttgcatatatcatgcattgtccgtaccaattgagctaa |
21638119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 24571614 - 24571678
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||| ||||| | |||||||||||| |
|
|
| T |
24571614 |
ggtggtggtcggagtttgaaccccagaccttgcatatattatgtattgttccaatcaactgagct |
24571678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 24740830 - 24740894
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||| || |||||||| || ||||||||||| |
|
|
| T |
24740830 |
gtggtggctggggtttgaaccccggatcttgcatacatcatacattgtccctaccaactgagcta |
24740894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 39966300 - 39966264
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcat |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39966300 |
ttggtggtggtcagggtttgaaccctggaccttgcat |
39966264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 43611489 - 43611429
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
43611489 |
gtcggggtttgaaccccataccttacatatattatgtattgtccataccaactgagctaaa |
43611429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 44860870 - 44860938
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| |||||||||||||| ||||||| ||| |||||||||||||| | |||||||||||| |
|
|
| T |
44860870 |
ttggtagtggccggggtttgaaccccagaccttggatattttatgcattgtccaaaccaactgagctaa |
44860938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 47528434 - 47528502
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||| || |||||||||||||| || |||||||||||| |
|
|
| T |
47528434 |
ttggtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaa |
47528502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 48100792 - 48100728
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
48100792 |
tggtggtcaaggtttgaaccccaaaccttgcatattttatgcattgtccataccaactgagctaa |
48100728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 156
Target Start/End: Complemental strand, 12212364 - 12212321
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcatt |
12212321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 176
Target Start/End: Original strand, 12783689 - 12783756
Alignment:
| Q |
109 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || |||| ||||| | ||||| ||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
12783689 |
tggtggtggccgaggttcgaaccttagacctcgcatatattatgcattgtccataccaattgagctaa |
12783756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 175
Target Start/End: Original strand, 28712527 - 28712589
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||| ||||||||||||| | | |||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
28712527 |
tggtgatcggggtttgaactccg-accttgcatatattatgcattgtgcataacaactgagcta |
28712589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 172
Target Start/End: Original strand, 32497481 - 32497532
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| | || |||||||| |
|
|
| T |
32497481 |
gggtttgaaccctagaccttgcatatattatgcattgttcctaccaactgag |
32497532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 159
Target Start/End: Original strand, 39252133 - 39252184
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||| || |||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
39252133 |
ttggtggtggttggagtttgaaccccggaccttgcatatattatgtattgtc |
39252184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 45190269 - 45190324
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || | |||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
45190269 |
gggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgaactaa |
45190324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 177
Target Start/End: Complemental strand, 49868059 - 49868016
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| |||| |
|
|
| T |
49868059 |
ggaccttgcatatattatgcattatccatatcaactgagttaaa |
49868016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 1454592 - 1454526
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| || |||||| ||| ||||| |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1454592 |
gtggtggtcaggatttgaatcctagacctcacatattttatgcattgtccatatcaactgagttaaa |
1454526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 1605456 - 1605402
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| |||| |||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcatattttatgcattgtccatactaactaagctaa |
1605402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 2817363 - 2817429
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| |||||| |||||| ||||||| |||| |||||||||||||| || ||||||||||||| |
|
|
| T |
2817363 |
gtggtgttcggggcttgaacttcggaccttacatatattatgcattgtccttaccaactgagctaaa |
2817429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 3937521 - 3937578
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacatta--tgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||||||| |||||||||||| |||| |||||||||| || ||||||||||| |
|
|
| T |
3937521 |
ggggtttgaaccccggaccttgcatatattatgtgcattgtccttaacaactgagcta |
3937578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 6000141 - 6000199
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||| | |||||||| |||| |
|
|
| T |
6000141 |
cggggtttgaacctcggaccttgcatatattatgcattgtcctaaccaactgagttaaa |
6000199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 6423751 - 6423813
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacat-tatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| || ||||||||| |||| |||||||| |
|
|
| T |
6423751 |
gtggtggccggggtttgaaccccggaccttgcatatataaatgcattgttcataccaactgag |
6423813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 7550964 - 7550906
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| ||| || |||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
7550964 |
gtggtcggggttcgaatcccggaccttgtatattttatgcattgttcatatcaactgag |
7550906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 8551413 - 8551482
Alignment:
| Q |
108 |
ttggtggtggtcgggg-tttgaaccctggaccttgcata-cattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| ||||| ||||||||| |||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
8551413 |
ttggtagtggccggggatttgaaccccggaccttgcatatctttatgcattgtcca-atcaactgagctaa |
8551482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 10843334 - 10843376
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
10843334 |
ggaccttgcatatattatgcattatccttatcaactgagctaa |
10843376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 16533031 - 16533089
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| ||| ||||||||||| |||||||||||| | || |||| |||||||| |
|
|
| T |
16533031 |
cggggtttgaatcctagaccttgcatatattatgcattgttcctaccaaccgagctaaa |
16533089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 16826402 - 16826360
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
16826402 |
ggaccttgcatattttatgcattgtccatagcaactgagctaa |
16826360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 22346744 - 22346682
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| || ||||||||| |||||||||||| ||||||||| |||| | |||||||||||| |
|
|
| T |
22346744 |
gtggtcaggatttgaaccccggaccttgcatattttatgcattatccaaaccaactgagctaa |
22346682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 23203390 - 23203328
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||| | | |||||||||||| |
|
|
| T |
23203390 |
gtggtcggggtttgaaccccgaaccttgcatattttatgcattgttccaaccaactgagctaa |
23203328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 26010293 - 26010227
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| |||||||||||| | ||||||||| ||||| ||||||| |||||| ||||||||| |
|
|
| T |
26010293 |
gtggtggtcagggtttgaaccccgaaccttgcatgtattatacattgtcactatcaattgagctaaa |
26010227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 28006809 - 28006747
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| ||| | |||| ||||||| ||||||||||||| |||| ||||||| |||| |
|
|
| T |
28006809 |
tggtcggggtttaaactccggactttgcatatattatgcattgtctatattaactgagttaaa |
28006747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 28016180 - 28016246
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| || ||||||||||||| ||| |||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
28016180 |
gtggtagttggggtttgaaccccggatcttgcatattttatgtattgtccatcccaactgagctaaa |
28016246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 30795761 - 30795707
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| ||||| ||||||||||||| |||||||||||| | || |||||||||||| |
|
|
| T |
30795761 |
ggttcgaaccttggaccttgcatatattatgcattgttcttaccaactgagctaa |
30795707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 31890739 - 31890805
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| ||||||| ||||| | | |||||| ||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
31890739 |
gtggcggtcgggatttgacctccggacctcgcatatattatgcattgtccttaccaactgagctaaa |
31890805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 34595943 - 34595877
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata-tcaactgagctaa |
176 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| |||||||||| ||| || |||||||| |||| |
|
|
| T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattatccttagtcaactgaactaa |
34595877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 36228638 - 36228572
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||| |||||||| | |||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
36228638 |
gtggtggccggagtttgaacttcgcaccttgcatattttatgcattgtccatatcaactaagctaaa |
36228572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 173
Target Start/End: Complemental strand, 36679649 - 36679599
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
36679649 |
gtttgaaccccggaccttgcatatattatccattgtcccgatcaactgagc |
36679599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 41884795 - 41884861
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||| |||||| |||||||| ||| |||||| |||||||| | |||||||||||| |
|
|
| T |
41884795 |
gtggtggccggggttcgaaccccggaccttgtatatattatgtattgtccaaactaactgagctaaa |
41884861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 41916556 - 41916614
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacat-tatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||| || ||||||| || |||||||||||| ||||||||||||||| |
|
|
| T |
41916556 |
cggggttcgaaccctgaactttgcatatatgtatgcattgtccctatcaactgagctaa |
41916614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 41974832 - 41974766
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| |||||||||| ||| |||||||||| ||||| |
|
|
| T |
41974832 |
gtggtggccggggtttgaacctcaaaccttgcatatattatgcattatccctatcaactgaactaaa |
41974766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 48646715 - 48646777
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||| |||||||||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
48646715 |
gtggtggccggagtttgaaccccggaccttgcatattattatgcattgtccatacaaactgag |
48646777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 49571204 - 49571138
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||| ||| || ||||||| |||||||||||||||| |
|
|
| T |
49571204 |
gtggtgttcggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaa |
49571138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 563260 - 563207
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| | |||||||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
563260 |
gtttgaactccggaccttgcatatattatgttttgtccttatcaactgagctaa |
563207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 175
Target Start/End: Complemental strand, 1755137 - 1755076
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||| |||||| || |||||||||| |
|
|
| T |
1755137 |
gtggtcagggtttgaacccgagaccttgcatatattatgcgttgtccctacaaactgagcta |
1755076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 2884450 - 2884499
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| || |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
2884450 |
gtttgaacccccgatcttgtatatattatgcattgtccatatcaactgag |
2884499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 2924605 - 2924537
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||| |||||||| | |||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2924605 |
ttggtggtggccgggatttgaacc-tagaccttatatattttatgcattgcccatatcaactgagctaaa |
2924537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 3528456 - 3528525
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| ||||| |||||| | ||||||| |||| ||||| |||||| |||||||||||||||| |
|
|
| T |
3528456 |
ttggtggtggccggggcttgaacaccggaccttacatatattatacattgtttctatcaactgagctaaa |
3528525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 5279361 - 5279426
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| ||||||||| | ||| ||||||| ||||||||||||||||| | |||||| |||| |
|
|
| T |
5279361 |
tggtggtcgaggtttgaactccagacattgcatatattatgcattgtccataccgactgagttaaa |
5279426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 7454568 - 7454629
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| | || |||||||||| ||||| ||||||| ||| ||| |||| |
|
|
| T |
7454568 |
gtggtggtcggggtttgaatcatgaaccttgcatatattatacattgtcgataccaattgag |
7454629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 9265826 - 9265887
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||||||||||| || |||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
9265826 |
gtggtggccggggtttgaatcccagaccttgcatgtattatacattgtccataccaactgag |
9265887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 11181925 - 11181990
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||| | |||||||||||||| ||| | |||||| |
|
|
| T |
11181925 |
gtggtggccggggtttgaaccccgcaccttgcatatttcatgcattgtccataccaattaagctaa |
11181990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 176
Target Start/End: Complemental strand, 13779621 - 13779584
Alignment:
| Q |
139 |
ttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
13779621 |
ttgcatatattatgcattgtctatatcaactgagctaa |
13779584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 13794522 - 13794563
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
13794522 |
gaccttgcatatattatgcattatccttatcaactgagctaa |
13794563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 14521015 - 14520950
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||| |||||| || ||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
14521015 |
gtggtggccggggttcgaaccccaaactttgcatattttatgcattgtccataccaactgagctaa |
14520950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 15382809 - 15382870
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||| || ||||| |||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
15382809 |
gtggtggccgggtttcgaacctcggaccttgcatatattatacattgttcatatcaactgag |
15382870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 177
Target Start/End: Original strand, 24124845 - 24124886
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
24124845 |
accttgcatatattatgcattgtccttaacaactgagctaaa |
24124886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 24978315 - 24978254
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||| ||| || ||| |||||||| |
|
|
| T |
24978315 |
gtggtggtcgggatttgaaccctaaaccttgcatatattatgtattatctataccaactgag |
24978254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 32075250 - 32075299
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||||||| | |||| ||||||| ||||||||||||||| |
|
|
| T |
32075250 |
gaaccctgaaccttgcatatactatgtattgtccttatcaactgagctaa |
32075299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 34632240 - 34632175
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| |||||||| ||| |||||||| ||||| ||||||| ||| |||||||||||| |
|
|
| T |
34632240 |
gtggtggccgggatttgaacctcggatcttgcatatattatacattgtctataccaactgagctaa |
34632175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 37244035 - 37243970
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||| ||||||||||| || ||||||| | |||| ||| ||||||||||||||||||| |
|
|
| T |
37244035 |
gtggtggccggaatttgaaccctgaacattgcatatactatgtattatccatatcaactgagctaa |
37243970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 40613094 - 40613045
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| | || |||||| |||||||||||| |||||||||||||| |
|
|
| T |
40613094 |
gtggtggtcgagattcgaaccccggaccttgcatatattatgcattgtcc |
40613045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 42767081 - 42767024
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||| |||||||| ||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
42767081 |
gtggccggggtttaaaccccagactttgcatacattatctattgtccatatcaactga |
42767024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 43545837 - 43545898
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
43545837 |
ttggtggtggtcgaggttcgaacccgtgaccttgcatattttatgcattgtcaataccaact |
43545898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 44718048 - 44718113
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| | | |||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
44718048 |
gtggtggtcggggtttgaaatccgaaccttgcatattttatctattgtccataccaactgagctaa |
44718113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 45003459 - 45003410
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
45003459 |
gtttgaaccccggaccttgcatatattatccattgtcccgatcaactgag |
45003410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 161
Target Start/End: Complemental strand, 46392307 - 46392254
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
161 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||| |||||||||| |||| |
|
|
| T |
46392307 |
ttggtggtggtcggaatttgaaccccggaccttggatatattatgcattatcca |
46392254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 46707931 - 46707878
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||||| || |||||| ||||| |
|
|
| T |
46707931 |
gtttgaaccccggaacttgcatatattatgcattgtccttaccaactgggctaa |
46707878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 49431983 - 49432028
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
||||||| |||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 51241559 - 51241498
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
||||||||| || | ||||||| |||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
51241559 |
ggtggtcggagtctaaaccctgaaccttgcatatattatgcattgtctctatcaactaagct |
51241498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 64665 - 64717
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||| || ||||||||| | |||| ||||||| |||||||||||||| |
|
|
| T |
64665 |
ttggtggtggacgaggtttgaactccggactttgcatatattatgcattgtcc |
64717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 132 - 172
Target Start/End: Original strand, 2889937 - 2889977
Alignment:
| Q |
132 |
ctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
2889937 |
ctggaccttgcatatattatgcattgtccctaccaactgag |
2889977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 4295308 - 4295240
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||||||| |||||| ||| |||||||||| |||| | |||||||||||| |
|
|
| T |
4295308 |
ttggtagtggtcggagtttgaaccccataccttggatatattatgcattatccaaaccaactgagctaa |
4295240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Complemental strand, 5280702 - 5280654
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| |||||||| |||| |
|
|
| T |
5280702 |
gtggtggtcggggttcgaaccccagaccttgcatatattatgcactgtc |
5280654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 7925437 - 7925370
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || ||||||||||| | ||||| |||| ||||||||||||| || |||||||||||| |
|
|
| T |
7925437 |
ttggtggtggccgaggtttgaaccccgaacctt-catatattatgcattgtctctaccaactgagctaa |
7925370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 10356702 - 10356749
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
10356702 |
ttggtggtggtcggg-tttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 11702040 - 11701988
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
11702040 |
ttggtagtggtcagggtttgcaccctggaccttacatattttatgcattgtcc |
11701988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 12522110 - 12522174
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||| |||| |||| ||| |||||||| |
|
|
| T |
12522110 |
tggtggtcggggtttgaacctcagaccttgtatatattatgcgttgttcataccaattgagctaa |
12522174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 15602167 - 15602231
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||||| | |||||| | |||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
15602167 |
gtggtggccggggctcgaacccagatccttacatatattatgcattgtccataccaactgagcta |
15602231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 17280072 - 17280139
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
17280072 |
ttggtggtggtcggggttcaaaccgcagaccttgcatgtatta-gcattgtccataccaactgagctaa |
17280139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 19262906 - 19262962
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||| | || ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
19262906 |
ggggttcgaaccccgaactttgcatatgttatgcattgtccttatcaactgagctaa |
19262962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 160
Target Start/End: Complemental strand, 22335428 - 22335380
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
22335428 |
tggtgttcggggtttgaacctcagaccttgcatatattatgcattgtcc |
22335380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 27172721 - 27172773
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||| |||||||| |||||| ||||||||| |||||||| |
|
|
| T |
27172721 |
ggggtttgaaccttggagcttgcatatattatgttttgtccataccaactgag |
27172773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 172
Target Start/End: Original strand, 29450973 - 29451033
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||||| || | |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
29450973 |
ggtggtcgggggttgaatcccgaaccttgcatattattatgcattgtccataccaactgag |
29451033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 30382570 - 30382506
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| || ||||||||| | ||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
30382570 |
ttggtggtggccgaggtttgaacgccagaccttgcatattttatgcattgtccaaaccaactgag |
30382506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 34808578 - 34808618
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
34808578 |
accttgcatatattatgcattgtccttaacaactgagctaa |
34808618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 39303016 - 39302952
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||| ||||||| || ||||||||||| |
|
|
| T |
39303016 |
gtggtggccggggtttgaaccaccgaccttgcatattttatgtattgtccttaccaactgagcta |
39302952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 43356509 - 43356457
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||||||||||||||||||| | ||||| |||| |||||||||||||| |
|
|
| T |
43356509 |
ttggtggtggtcggggtttgaactccaaaccttacatatattatgcattgtcc |
43356457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 44346243 - 44346207
Alignment:
| Q |
141 |
gcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
44346243 |
gcatatattgtgcattgtccatatcaactgagctaaa |
44346207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 44678020 - 44678072
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcattgtctatacaaactgagctaa |
44678072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 155
Target Start/End: Original strand, 46149034 - 46149078
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
155 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
46149034 |
gtggtggccggggtttgaaccttggaccttgcatataatatgcat |
46149078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 172
Target Start/End: Original strand, 48264474 - 48264522
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| |||||| |||||||| |
|
|
| T |
48264474 |
tttgaactctggaccttgcatattttatgcattatccataccaactgag |
48264522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 7e-19; HSPs: 168)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 25340911 - 25340979
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
25340911 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
25340979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 38130946 - 38131010
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
38130946 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgag |
38131010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 25441490 - 25441555
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
25441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 48209198 - 48209267
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
48209198 |
ttggtggtggtcggggtttgaaccctgaaccttatatatattatgtattgtccctatcaactgagctaaa |
48209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 51882190 - 51882251
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
51882190 |
gtggtggccggggtttgaaccctggatcttgcatatattatgcattgtccataccaactgag |
51882251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 16792961 - 16793029
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||| |||||| ||||| |
|
|
| T |
16792961 |
ttggtggtgaccggggtttgaaccctggaccttgcatatattatgcattgtctataccaactgtgctaa |
16793029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 29631260 - 29631192
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| || | |||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29631260 |
ttggtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgagctaa |
29631192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 34899167 - 34899103
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
34899167 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctacgaactgagctaa |
34899103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 111 - 173
Target Start/End: Original strand, 8136622 - 8136684
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| |||| |||| |
|
|
| T |
8136622 |
gtggtggtcggggtttgaaccttggaccttgcatatattatgcatcgtccataccaaccgagc |
8136684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 7464481 - 7464542
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| |||||||||||||| || |||||||| |
|
|
| T |
7464481 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctaccaactgag |
7464542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 21549105 - 21549044
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| ||||||| |||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
21549105 |
tggtcggggttcgaaccctaaaccttgcatatattatacattgtccatatcaactgagctaa |
21549044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 110 - 163
Target Start/End: Original strand, 25727956 - 25728009
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
25727956 |
ggtggtggtcgggatttgaaccccggaccttgcatatattatgcattgtccata |
25728009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 45432019 - 45431954
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
45431954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 50037370 - 50037317
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50037370 |
gtttgaaccccgaaccttgcatacattatgcattgtccataccaactgagctaa |
50037317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 552248 - 552184
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||| | ||| || |||||||| |
|
|
| T |
552248 |
ttggtggaggtcggggtttgaaccctggaccttgcatatattatgcaatatccctaccaactgag |
552184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 4601918 - 4601854
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
4601918 |
ttggtggtggccggggtttgaaccccggaccttgcatttattatgcattgtccaaaccaactgag |
4601854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 45727560 - 45727508
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45727560 |
gtggtggtcggagtttgaaccctaaaccttgcatacattatgcattgtccata |
45727508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 1111834 - 1111897
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||| |||| |
|
|
| T |
1111834 |
gtggtcggggtttgaaccccagaccttgcatatattatgtattgtccctatcaactgagttaaa |
1111897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 3755411 - 3755344
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||| |||||||||||||| || |||| |||||||| |
|
|
| T |
3755411 |
ggtggtggccgaggtttaaaccctggaccttgcatatattatgcattgtccctaccaaccgagctaaa |
3755344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 109 - 176
Target Start/End: Original strand, 10498683 - 10498750
Alignment:
| Q |
109 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| || ||||||||| | ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10498683 |
tggtggtggccgaggtttgaactcatgaccttgcatatattatgcattgtccataccaactgagctaa |
10498750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 112 - 175
Target Start/End: Complemental strand, 39779094 - 39779031
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcattgtccataccaaccgagcta |
39779031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 11508476 - 11508538
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||| || ||||||||||||||||||| ||||||| |
|
|
| T |
11508476 |
gtggtcggggttcgaaccccggaccctgcatatatcatgcattgtccatatcaaccgagctaa |
11508538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 16980347 - 16980409
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||| || |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
16980347 |
gtggtcgggatttgaaccatgaaccttgcatatattatgcattgtccttaccaactgagctaa |
16980409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 48315017 - 48315079
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||||| ||| || |||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcattatccttaccaactgagctaa |
48315079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 53821841 - 53821799
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53821841 |
ggaccttgcatacattatgcattgtccatatcaactgaactaa |
53821799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 7557524 - 7557585
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| || ||||||| | | |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7557524 |
gtggtggccgaggtttgatcgccggaccttgcatacattatgcattgtccataccaactgag |
7557585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 10922298 - 10922359
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||||||||||||||| ||| |||||||| |||||||||||||| || |||||||| |
|
|
| T |
10922298 |
gtggtagtcggggtttgaaccccggatcttgcatatattatgcattgtccctaccaactgag |
10922359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 14827596 - 14827531
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||| ||||| ||| |||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
14827596 |
gtggtggccggggtttaaaccccggatcttgcatattttatgcattgtccataccaactgagctaa |
14827531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 18870715 - 18870780
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| || |||||||| | ||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
18870715 |
gtggtggccgaggtttgaatcatggaccttgcatatattatgcattgtccctaccaactgagctaa |
18870780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 22722473 - 22722408
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
22722473 |
gtggtggtcggggtttgaacctcggaccttgcatattttatgcattgttcatactaactgagctaa |
22722408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 27185548 - 27185483
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
27185548 |
gtggtggtcgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaa |
27185483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 32629151 - 32629086
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||| |||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
32629151 |
gtggtggtcgatgttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
32629086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 32843252 - 32843317
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattgtccaaaccaactgagctaa |
32843317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 44579699 - 44579642
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
44579699 |
cggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
44579642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 46903967 - 46903918
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| |||||||| |
|
|
| T |
46903967 |
gtttgaaccctggaccttacatatattatgcattgtccataccaactgag |
46903918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 48849753 - 48849813
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt-cataccaactgag |
48849813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 53996370 - 53996305
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| || |||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
53996305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 54113403 - 54113346
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
54113403 |
ggggttcgaacccgggaccttgcatacatttatgcattgtctatatcaactgagctaa |
54113346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 977944 - 977996
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgtccataccaactgagctaa |
977996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 986940 - 986992
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
986940 |
ttggtagtggtcggggtttgaaccctggaccttgcatattttatacattgtcc |
986992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 3100295 - 3100227
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
3100295 |
ttggtggtggccggggttcaaaccctggactttgcatatgttatgcattgtccacaccaactgagctaa |
3100227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 115 - 163
Target Start/End: Original strand, 30554869 - 30554917
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
163 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
30554869 |
tggtcggggtttgaaccctgaaccttgcatatagtatgcattgtccata |
30554917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 33745161 - 33745105
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
33745161 |
ggggtttgaaccccagaccttgcatattttatgcattgtccatatcaattgagctaa |
33745105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 41817573 - 41817509
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
41817573 |
ttggtggtggctagggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgag |
41817509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 48944343 - 48944406
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||||| |||||||||||||||| |||||||| |
|
|
| T |
48944343 |
ttggtggtggtcggagtttgaaccct-gatcttgcatatattatgcattgtccattgcaactgag |
48944406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 115 - 171
Target Start/End: Original strand, 49082703 - 49082759
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || || ||||||||||| ||||||| |
|
|
| T |
49082703 |
tggtcggggtttgaaccccggaccttgcatatatcatacattgtccataccaactga |
49082759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 52119446 - 52119382
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||| |||||| | |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
52119382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 52904131 - 52904198
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
52904131 |
ttggtggtgg-cggggtttgaacccccgacattgcatatattatgcattgtccttaccaactgagctaa |
52904198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 334837 - 334904
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||| ||||||||| |||||||| |||| |
|
|
| T |
334837 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcatttgtccataccaactgagttaaa |
334904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 1149069 - 1149124
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
1149069 |
gggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaa |
1149124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 172
Target Start/End: Original strand, 16663236 - 16663287
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| |||||| |||||||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcattatccataccaactgag |
16663287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 20370281 - 20370336
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20370281 |
gggttcgaaccctaaaccttgcatattttatgcattgtccatatcaactgagctaa |
20370336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 24428473 - 24428528
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
24428473 |
gggtttgaacctcggactttgcatatattatgcattgtccataccaactgagctaa |
24428528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 35347288 - 35347351
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcatttgtccatagcaactgagctaa |
35347351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 45334263 - 45334204
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaa |
167 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||| |||||||||||| | |||||| |
|
|
| T |
45334263 |
ttggtggtggtcgggatttgaaccccgaaccttgcatatattatgcattgttcttatcaa |
45334204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 7827579 - 7827513
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| || |||| | |||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
7827579 |
gtggtggtcgggtttcgaactccagaccttacatatattatgcattgtccatatcaactgagttaaa |
7827513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 17507688 - 17507754
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| | ||||| ||| || | |||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17507688 |
ggtggtggcccgggttcgaatcccgaaccttgcatatattatgcattgtcaatatcaactgagctaa |
17507754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 23147967 - 23148033
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||| |||||| |||||| ||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
23147967 |
ggtggtgttcggggttcgaaccccggacctcgcatatattatgtattgtccttaccaactgagctaa |
23148033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 43344997 - 43345063
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| |||||| | ||||| |||||||||||||| |||||| ||||| |||| ||||||||||||| |
|
|
| T |
43344997 |
gtggttgtcgggatctgaactctggaccttgcatatattatgtattgttcataccaactgagctaaa |
43345063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 47040887 - 47040949
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| | |||||||| | ||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
47040887 |
gtggtcggagcttgaaccccgaaccttacatacattatgcattgttcatatcaactgaactaa |
47040949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 52576019 - 52575953
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
52576019 |
ggtggtggtcgggattcgaaccccagaccttgcatattttatgcattgttcataccaactgagctaa |
52575953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 53047848 - 53047786
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||| | || ||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
53047848 |
gtggtcggggtttgaaccccgaactttgcatacattatcaattgttcataccaactgagctaa |
53047786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 2186421 - 2186478
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||| |||||| |||| |||||| |||||||||| |||||||| |
|
|
| T |
2186421 |
tggtcggggtttgaaccccagaccttacatatattatgtattgtccataccaactgag |
2186478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 4216413 - 4216454
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4216413 |
gaccttgcatatattatgcattgtccttatcaactgagctaa |
4216454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 7824881 - 7824812
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| || |||| | ||||||||||| |||||| |||||| |||||||||||| |||| |
|
|
| T |
7824881 |
ttggtggtggtcgggtttcgaactccagaccttgcatatattatgtattgtctatatcaactgagttaaa |
7824812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 21160122 - 21160062
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
21160122 |
gtggtggt-ggggtttgaacccccgaccttacatatattatgcattatccatatcaactgag |
21160062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 21331423 - 21331472
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
21331423 |
gaaccccgaaccttgcatatattatgcattgtccataacaactgagctaa |
21331472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 28244094 - 28244155
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||| |||||| |||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
28244094 |
gtggtgatcggggttcgaaccccggaccttgcatattttatgcattgttcataccaactgag |
28244155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 31138487 - 31138427
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| | || |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
31138487 |
gtggtggtcggggtttgaacc-tagatcttgcatatattatgcattgtctctatcaactgag |
31138427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 32625406 - 32625475
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| |||||| | ||||||| |||||||||||| |
|
|
| T |
32625406 |
ttggtggtggtcggggtttgaaccctaaaccttgtatatattatgtaaggtccatacaaactgagctaaa |
32625475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 32909291 - 32909352
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| |||| ||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32909291 |
gtggtggccgggatttgaacccaggaccttgcatattttatgcattgtccatactaactgag |
32909352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 35863803 - 35863868
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
35863803 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttaccaactgagctaa |
35863868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 40520823 - 40520762
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
40520823 |
gtggtggtcggggtttgaactttggaccttgcatattttatgcattatccatacaaactgag |
40520762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 45096073 - 45096032
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45096073 |
gaccttgcatatattatgcattgtccttatcaactgagctaa |
45096032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 48796208 - 48796273
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
48796208 |
gtggtggccggggtttgaaccccgaaccttgcatatcttatgcattgtccaaactaactgagctaa |
48796273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 49975807 - 49975856
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
49975807 |
gtttgaaccccagaccttgcatatattatgcattgtccataacaactgag |
49975856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 136 - 177
Target Start/End: Complemental strand, 51505919 - 51505878
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51505919 |
accttgcatattttatgcattgtccatatcaactgagctaaa |
51505878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 3612169 - 3612237
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| |||||||| ||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3612169 |
ttggtggtggctggggattgaaccccggagcttatatatattatgcattatccatatcaactgagctaa |
3612237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 4332654 - 4332722
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||| ||| |||||||||| | || | |||||||||||| |
|
|
| T |
4332654 |
ttggtagtggtcggagtttgaaccccggaccttggatatattatgcattattcaaaccaactgagctaa |
4332722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 7651260 - 7651196
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||| ||| | |||||||||||| ||||||||||| |
|
|
| T |
7651260 |
ttggtggtggtcggcgtttgaaccccgaaccttatatatactatgcattgtccctatcaactgag |
7651196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 10926527 - 10926475
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
10926475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 13800741 - 13800673
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||| |||||||||||| | || |||||||||||| |
|
|
| T |
13800741 |
ttggtggtgtccggggttcgaactgtggaccttgcatatattatgcattgttcttaccaactgagctaa |
13800673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 175
Target Start/End: Complemental strand, 14894780 - 14894719
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14894780 |
tggtggtcagggtttgaaccttggacc--gcatatattatgcattgtccatagtaactgagcta |
14894719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 17755195 - 17755127
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||| |||||| ||||| | ||||||||||||||| |
|
|
| T |
17755195 |
ttggtggtggtcggaatttgaaccccgaaccttacatatattatgtattgttcctatcaactgagctaa |
17755127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 19056515 - 19056447
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||| |||||| ||||| | ||||||||||||||| |
|
|
| T |
19056515 |
ttggtggtggtcggaatttgaaccccgaaccttacatatattatgtattgttcctatcaactgagctaa |
19056447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 21628875 - 21628943
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||||||| |||||||||| |||| ||| ||| |||||||||| |||| | |||||||||||| |
|
|
| T |
21628875 |
ttggtagtggtcggagtttgaaccccggacgttggatatattatgcattatccaaaccaactgagctaa |
21628943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 27065731 - 27065771
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27065731 |
ggggtttgaaccctggaccttgcatattttatgcattgtcc |
27065771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 35191816 - 35191872
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
35191816 |
ggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaa |
35191872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 38603032 - 38602984
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
38603032 |
ttggtggtggccggggtttgaaccatgaaccttgcatatattatgcatt |
38602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 38894111 - 38894043
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
38894111 |
ttggtggtggtcgaaattcgaaccccggaccttgcatattttatacattgttcatatcaactgagctaa |
38894043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 174
Target Start/End: Complemental strand, 44582796 - 44582732
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
44582796 |
gtggtggccggggttcgaaccccggaccttgcatattattatgcattgcccataccaactgagct |
44582732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 45885468 - 45885532
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
45885468 |
tggtggccggggtttgaacctcagaccttgcatatattatgcaaggtccataccaactgagctaa |
45885532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 46483321 - 46483253
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||| |||| | |||| ||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
46483321 |
ttggtggtggctggggttcgaactccggactttgcatatattatgcattgtccataccaactaagctaa |
46483253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 52456552 - 52456488
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||||| ||||| |||||| ||||||| |||| ||||||||| |||||| ||||||||||| |
|
|
| T |
52456552 |
gtggtggtcagggttcgaaccccggaccttacatattttatgcattatccataacaactgagcta |
52456488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 55066587 - 55066655
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||| ||||||||| |||| |||||| |||||||||| ||| || |||||||||||| |
|
|
| T |
55066587 |
ttggtggtggccgggatttgaaccccagaccatgcatatattatgcattatccgtaccaactgagctaa |
55066655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 122 - 177
Target Start/End: Original strand, 5428437 - 5428492
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
5428437 |
ggtttgaatcctggaccttgcatatattatgcattgtttttatcaattgagctaaa |
5428492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 6835841 - 6835884
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgca |
154 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
6835841 |
gtggtggtcggggttcgaaccctagaccttgcatatattatgca |
6835884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 176
Target Start/End: Complemental strand, 20537927 - 20537888
Alignment:
| Q |
137 |
ccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
20537927 |
ccttccatatattatgcattgtccatatcaactgagctaa |
20537888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 39100073 - 39100140
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccct-ggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| || |||||||||| | |||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
39100073 |
gtggtggccgaggtttgaaccatcggaccttgcatatattatgcattgtttataacaactgagctaaa |
39100140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 39481206 - 39481147
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||||| | | ||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
39481206 |
gtcggggtttgaaccccgaatcttacataatttatgcattgtccataccaactgagctaa |
39481147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 46298048 - 46298111
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| |||||||||| |||| | ||||||||||||| |
|
|
| T |
46298048 |
gtggtcagggtttgaacctcggacattgcatatattatgcattatccaaaccaactgagctaaa |
46298111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 51047159 - 51047218
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| ||||| ||||||||||| ||||| |
|
|
| T |
51047159 |
gtggtggtcggggtttgaaccccggaccttacatattattatacattgtccataccaact |
51047218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 51402706 - 51402769
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| || ||| |||||| ||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51402706 |
gtggttggagttcgaaccccagacgttgcatgtattatgcattgtccatatcaactgagctaaa |
51402769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 759595 - 759649
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
759595 |
ggtttgaaccctgaactttgcatatattatgcattgtccctaccaactgaactaa |
759649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 913587 - 913641
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
162 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
913587 |
ttggtggtggcagaggtttgaaccccggaccttgcatatattatgcattgcccat |
913641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 7202914 - 7202972
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| | | ||||||||||||| |
|
|
| T |
7202914 |
cggggtttgaaccctgaaccttgcatattttatgcattgttccaaccaactgagctaaa |
7202972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 135 - 177
Target Start/End: Complemental strand, 7829943 - 7829901
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
7829943 |
gaccttacatatattatgcattgtccatatcaactgagttaaa |
7829901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 10102870 - 10102812
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| |||||||||||||||||| |||||| |||||||||||||| || ||||| |
|
|
| T |
10102870 |
gtggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctaccaact |
10102812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 10213793 - 10213735
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| |||||||||||||||||| |||||| |||||||||||||| || ||||| |
|
|
| T |
10213793 |
gtggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctaccaact |
10213735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 11358306 - 11358240
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| |||||||||||||| ||| |||||||| |||||| |||||| || |||| ||||||| |
|
|
| T |
11358306 |
ggtggtggccggggtttgaaccccggatcttgcatatattatgaattgtcgctaccaaccgagctaa |
11358240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 135 - 177
Target Start/End: Original strand, 12976616 - 12976658
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
12976616 |
gaccttgcatatattatgcattgtccctatcaactgagttaaa |
12976658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 14030722 - 14030784
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactg |
170 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| ||||||| |||||| || |||||| |
|
|
| T |
14030722 |
ttggtggtggtcggggtttgaactccaaaccttgcatatattatgcgttgtccctaccaactg |
14030784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 134 - 172
Target Start/End: Complemental strand, 19468499 - 19468461
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
19468499 |
ggaccttgcatatattatgcattgtccataccaactgag |
19468461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 24145467 - 24145408
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||| |||||||||||||| || |||||||| |
|
|
| T |
24145467 |
gtggtgatcggggtttgaacc--ggaccttgtatatattatgcattgtccctaccaactgag |
24145408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 27397610 - 27397668
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| ||||| | ||||||||||| ||||| ||||||||||| |||||||| |||| |
|
|
| T |
27397610 |
cggggttcgaaccttagaccttgcatatattatacattgtccataccaactgagttaaa |
27397668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 28052388 - 28052438
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||| |||||||||| ||||| |
|
|
| T |
28052388 |
gaaccctggaccttggataaattatgcgttgtccctatcaactgaactaaa |
28052438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Original strand, 35548283 - 35548344
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| || ||| |||||||| ||||| |||||| |||| ||||||||||||| |
|
|
| T |
35548283 |
tggtcggggtttgaatcc-ggagcttgcatatattatacattgttcataccaactgagctaaa |
35548344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 46090193 - 46090259
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||| |||| | ||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
46090193 |
gtggtgttcggggttcgaactcgcgaccttgcatatatttatgcattgtctatatcaactgagctaa |
46090259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 47099028 - 47099090
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||| ||||||||| | |||||||||| |||||||||| | | ||||||||||||||| |
|
|
| T |
47099028 |
gtggttgggatttgaaccccgaaccttgcatatattatgcattattcttatcaactgagctaa |
47099090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 48657807 - 48657873
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||| |||||| | | ||| |||| |||||| ||||||| |||||||| ||||||| |
|
|
| T |
48657807 |
gtggtggtcggggttcgaaccccgaatcttacatatattatggattgtccctatcaactaagctaaa |
48657873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 54018396 - 54018454
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||| | || ||||||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
54018396 |
gtggtggccaggatttgaaccctgaaccttgcatattttatgcattgtccataccaact |
54018454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 54203818 - 54203888
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||| || ||||||||||| ||||||||||| ||| || ||||||| ||||||||||||||||| |
|
|
| T |
54203818 |
ttggtggtgtccgaggtttgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaaa |
54203888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 54230097 - 54230155
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||| |||||| |||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
54230097 |
cggggttcgaaccccaaaccttgcatatattatgcattgtccttaccaactgagctaaa |
54230155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 916510 - 916461
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
916510 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
916461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 7738732 - 7738679
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
7738732 |
cggggcttgaaccccggaccttgcatattttatgcattgtccctaccaactgag |
7738679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 7757154 - 7757089
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||| |||| |||||||||| ||||||| |||| |
|
|
| T |
7757154 |
gtggtggtcggggttcgaactctgaaccttgcatattttatatattgtccataccaactgaactaa |
7757089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 8075856 - 8075795
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||| ||| ||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtctctattaactgag |
8075795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 8113552 - 8113617
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||| || ||||| ||| |||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
8113552 |
gtggtggccgggattcgaaccgcggatcttgcatatattatgcattgtccttaccaactgagctaa |
8113617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 8238635 - 8238586
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| ||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtcc |
8238586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 122 - 171
Target Start/End: Complemental strand, 10594737 - 10594688
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| || ||||||| |
|
|
| T |
10594737 |
ggtttgaaccctaaaccttgcatatattatgcattgtccttaccaactga |
10594688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 176
Target Start/End: Complemental strand, 21245860 - 21245799
Alignment:
| Q |
115 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||||||||| |||||| |||| |||||||||||||| || ||||| |||||| |
|
|
| T |
21245860 |
tggtcgaggtttgaaccccagaccttacatatattatgcattgtccttaccaactaagctaa |
21245799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 21506772 - 21506813
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
21506772 |
gaccttgcatattttatgcattgtccataccaactgagctaa |
21506813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 21513335 - 21513294
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
21513335 |
gaccttgcataaattatgcattgtccttaccaactgagctaa |
21513294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 118 - 171
Target Start/End: Complemental strand, 25876473 - 25876420
Alignment:
| Q |
118 |
tcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||||||| || ||||||| |
|
|
| T |
25876473 |
tcggggtttgaaccatacactttgcatacattatgcattgtccttaccaactga |
25876420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 27999695 - 27999752
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||| ||||||||| || ||||| |||||| |||||||||||| |
|
|
| T |
27999695 |
cggggtttgaaccccagactttgcatacaatacgcattatccataccaactgagctaa |
27999752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 28266771 - 28266722
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgaactaa |
28266722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 29687153 - 29687088
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| ||||| |||||||| | |||||||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
29687153 |
gtggtgatcgggatttgaaccttaaaccttgcatataatatatattgtccatatcaactgagctaa |
29687088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 32753887 - 32753838
Alignment:
| Q |
123 |
gtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| || ||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
32753887 |
gtttgaaccccgggccttgtatatattatgcattgtccctatcaactgag |
32753838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 43490431 - 43490472
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
43490431 |
gaccttgcatatattatgcattgttcataccaactgagctaa |
43490472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 44075146 - 44075195
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44075195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 47039498 - 47039437
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| || |||||| | || ||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
47039498 |
gtggtggtcgggattcgaaccccgaactttgcatatattatgcattgtccttatcatctgag |
47039437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 122 - 159
Target Start/End: Original strand, 48656900 - 48656937
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgtc |
48656937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 138 - 171
Target Start/End: Original strand, 52201517 - 52201550
Alignment:
| Q |
138 |
cttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
52201517 |
cttgcatatattatgcattgtccatatcaactga |
52201550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 171
Target Start/End: Original strand, 2153491 - 2153551
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||||| | |||||| ||||| ||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
2153491 |
gtggtggccagggtttaaaccccagaccttgcatatattatgcattgtccaaaccaactga |
2153551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 3582856 - 3582788
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||||||||| ||| | |||||||||||| |
|
|
| T |
3582856 |
ttggtggtggtcatggtttgaacctcggaccttgcatattttatgcattctcccaaccaactgagctaa |
3582788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 8831348 - 8831400
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| | |||||||| |||||| ||||| |||| |||||||||||| |
|
|
| T |
8831348 |
tttgaaccctgaatcttgcatatattatgtattgtacataccaactgagctaa |
8831400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 9321420 - 9321460
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
9321420 |
accttgcatatattatgcattgtccaaaccaactgagctaa |
9321460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 15881164 - 15881096
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || |||| |||||| | | |||||||| | |||||||||||||||||||| |||||| |
|
|
| T |
15881164 |
ttggtggtggccgaggttcgaaccccgaatcttgcatatttaatgcattgtccatatcaacttagctaa |
15881096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 20296365 - 20296305
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||| |||||||||||||||| | |||||| |
|
|
| T |
20296365 |
gtggtcgtcggggtttgaacatcggactttgcatatattatgcattgtccatgttaactga |
20296305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 20612264 - 20612332
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||| |||||||||||| || |||| |||||||| |
|
|
| T |
20612264 |
ttggtagtggccggggtttgaaccccaaaccttgcatatattatgcattgttcaagtcaaatgagctaa |
20612332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 22799716 - 22799780
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||| || |||||||||| |
|
|
| T |
22799716 |
gtggtggtcgaggtttgaacctcggaccttgcatgttttatgcattgtccttacaaactgagcta |
22799780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 25527825 - 25527889
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||| ||| ||||||||| ||| ||||||| |||||| ||||| |||| |||||||| |
|
|
| T |
25527825 |
ttggtggtggttgggttttgaaccccggaacttgcatgtattatgaattgttcataccaactgag |
25527889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 30200872 - 30200832
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
30200872 |
accttgcatatattatgcattgtccttagcaactgagctaa |
30200832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 31214708 - 31214660
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
156 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||| |||| |||||||||| |
|
|
| T |
31214708 |
ttggtggtggtcggagtttgaatcccggaccttacatatattatgcatt |
31214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 32484339 - 32484283
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| |||||||||||| |||||||| |||| |
|
|
| T |
32484339 |
gggtttgaaccccggatcttgcatattttaagcattgtccataccaactgagttaaa |
32484283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 32836247 - 32836179
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| | |||| |||| ||| ||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
32836247 |
ttggtggtggctgaggttcgaactctgaaccgtgcatattttatgcattgtccataccaactgagctaa |
32836179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 38573560 - 38573624
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||| ||||||| ||| ||| ||||||| ||| |||||||||||| | ||||||||||| |
|
|
| T |
38573560 |
ttggtggtgtccggggttcgaatcctagaccttgtatatattatgcattgttcttatcaactgag |
38573624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 38949746 - 38949682
Alignment:
| Q |
113 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| |||||||| |||||| || || |||||| |||||||| ||||| || ||||||||||||| |
|
|
| T |
38949746 |
ggtgttcggggttcgaaccccggcccctgcataaattatgcaatgtccctaccaactgagctaaa |
38949682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 39822178 - 39822226
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||| || ||||||||||| |
|
|
| T |
39822178 |
gaaccccggaccttgtatatattatgcattgtccttaccaactgagcta |
39822226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 40575612 - 40575664
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||| || |||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcattgtctatactaattgagctaa |
40575664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 43011392 - 43011332
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||| ||||||||| | || ||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
43011392 |
tggtggtcagggtttgaatcatgtaccttgcatgtattatgtattgtctatatcaactgag |
43011332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 167
Target Start/End: Original strand, 44799045 - 44799101
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaa |
167 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| ||||| ||||| | |||||| |
|
|
| T |
44799045 |
gtggtgatcggggtttgaaccctggactttgcatattttatgtattgttcttatcaa |
44799101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 48022304 - 48022352
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
||||||||||| |||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
48022304 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcattgtc |
48022352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 134 - 174
Target Start/End: Complemental strand, 48511298 - 48511258
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
48511298 |
ggaccttgcatatattatgcattgtccctaccaactgagct |
48511258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Original strand, 50570204 - 50570244
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
50570204 |
accttgcatatattatgcattgtctataccaactgagctaa |
50570244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 176
Target Start/End: Original strand, 52453244 - 52453312
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| || |||||||||| | || ||||||| |||||||||||||| ||| |||| |||||| |
|
|
| T |
52453244 |
ttggtggtggacgaggtttgaacctcgaactttgcatatattatgcattgtccctattaactaagctaa |
52453312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 53162244 - 53162204
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
53162244 |
accttgcatattttatgcattgtccatatcaattgagctaa |
53162204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 55126068 - 55126012
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||| | |||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
55126068 |
ggggtttgaacctcgaaccttgcatatattatgtattgtcctcatcaactgagctaa |
55126012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 61557 - 61621
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||| ||| || |||||||| |
|
|
| T |
61557 |
ttggtggtggccggggtttgaaccctggaccttacatacattatgcattatccttaccaactgag |
61621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 161215 - 161151
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
161215 |
ttggtggtggtcggggtttgaaccccgaaccttgcatattttatgcattgtccataccaactgag |
161151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1694 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold1694
Description:
Target: scaffold1694; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 215 - 161
Alignment:
| Q |
122 |
ggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
215 |
ggtttgaacctcagaccttgcatacattatgcattgtccatatcaactgagctaa |
161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 4529 - 4471
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
4529 |
cgggatttgaaccctggaccttgcataaattatgcattgtccctatcaactaagctaaa |
4471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 17805 - 17737
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
17805 |
ttggtggtggctggggtttgaaccc-ggaccttgcatgtattatgcattgtccataccaactgagctaaa |
17737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 1602 - 1534
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
1602 |
ttggtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
1534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 117 - 176
Target Start/End: Original strand, 72771 - 72831
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgt-ccatatcaactgagctaa |
176 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
72771 |
gtcggagtttgaaccctggaccttgcatatattatgcattgtcccatatcaactgaactaa |
72831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 28106 - 28169
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||| ||||||||||| || |||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
28106 |
gtggccggggtttgaatcccagaccttgcatacgttatgcattgtccataccaactgagctaaa |
28169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 5253 - 5187
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
5253 |
gtggtggttggggtttgaacctcagaccttgcatatattatgcattgtccataccaattgagctaaa |
5187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 173
Target Start/End: Original strand, 31912 - 31974
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagc |
173 |
Q |
| |
|
||||||| ||| || ||||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
31912 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagc |
31974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 171
Target Start/End: Complemental strand, 109181 - 109144
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
109181 |
ggaccttgcatatattatgcattgtccataccaactga |
109144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 221003 - 221069
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| |||||| ||| ||| || ||||||||||||| |
|
|
| T |
221003 |
gtggtggtcggggtttgaaccctagactttgcatatattatgtattatccctaccaactgagctaaa |
221069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 176
Target Start/End: Complemental strand, 244513 - 244485
Alignment:
| Q |
148 |
ttatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
244513 |
ttatgcattgtccatatcaactgagctaa |
244485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 1319 - 1254
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||| |||||||| | |||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
1319 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtccatatcaactgagctaa |
1254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 5487 - 5418
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||||||| | |||||| ||||||||||| |||||||||||||||| |||| |||||||| |
|
|
| T |
5487 |
ttggtggtggtcggggatcgaaccccagaccttgcatattttatgcattgtccataccaaccgagctaaa |
5418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 176
Target Start/End: Complemental strand, 58928 - 58859
Alignment:
| Q |
108 |
ttggtggtgg-tcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
58928 |
ttggtggtgggtcggggtttaaacctcggaccttgtatacattatgcattatccataccaactgagctaa |
58859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 56854 - 56790
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| |||||||||| | ||||||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
56854 |
gtggtggctggggtttgaaac-tggaccttgcatatattatacattgtccataccaactgagctaa |
56790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 99108 - 99047
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||| ||||| |||||||||| ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
99108 |
gtggttgtcggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
99047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 7793 - 7732
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
7793 |
gtggtggtcggggtttgaacctcggaccttgcatgttttatgcattgtccataccaactgag |
7732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 185326 - 185269
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
185326 |
cggggtttgaaccccggatcttgcatattttatgcattgtccataccaactgagctaa |
185269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 25451 - 25399
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
25451 |
ggggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgag |
25399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 64288 - 64224
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
64288 |
tggtggtcggggttcgaatcccggaccttgcatatattatgcattgtccataccagttgagctaa |
64224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 174
Target Start/End: Complemental strand, 75396 - 75333
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
||||||| |||| || |||||| |||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagct |
75333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 14176 - 14242
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |||| |||||||| |||| |
|
|
| T |
14176 |
gtggtggtcggggtttgaaccacataccttgcatatattatgcattgttcataccaactgagttaaa |
14242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 138 - 177
Target Start/End: Original strand, 31172 - 31211
Alignment:
| Q |
138 |
cttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
31172 |
cttgcatatattatgcattgtccataccaactgagctaaa |
31211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 239870 - 239812
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||||| | |||| ||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
239870 |
cggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagctaaa |
239812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 172
Target Start/End: Original strand, 34894 - 34939
Alignment:
| Q |
127 |
gaaccctggaccttgcatacattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
34894 |
gaaccctggaccttgcatatattatgcattgtccttaccaactgag |
34939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 53370 - 53419
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
160 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
53370 |
gtggtggtcggggtttgaaccccagaccttgcatattttatgcattgtcc |
53419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 40044 - 40004
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
40044 |
accttgcatatattatgcattgtccataccaactgagctaa |
40004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0674 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0674
Description:
Target: scaffold0674; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 175
Target Start/End: Complemental strand, 6784 - 6721
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||| ||||||| ||||| |||| |||||||| |||||||||||| || |||| |||||||| |
|
|
| T |
6784 |
tggtggccggggttcgaaccatggaacttgcatatattatgcattgttcaaatcagctgagcta |
6721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 159
Target Start/End: Original strand, 73511 - 73558
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
159 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
73511 |
tggtggtcggagtttgaaccccggacattgcatacactatgcattgtc |
73558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 35928 - 35983
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||| || ||| |||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
35928 |
gggtttgaaccctagaacttacatatattgtgcattgtccctatcaactgagctaa |
35983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 75252 - 75193
Alignment:
| Q |
114 |
gtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatatcaactgag |
172 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||| |||||| |||||||| |
|
|
| T |
75252 |
gtggtcggggttcgaactctggaccttgcatattattatgcattatccataccaactgag |
75193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 17785 - 17731
Alignment:
| Q |
121 |
gggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17785 |
gggtttgaacc-tggaccttatatatattatgcattgtccaaatcaactgagctaa |
17731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 120 - 158
Target Start/End: Original strand, 1164 - 1202
Alignment:
| Q |
120 |
ggggtttgaaccctggaccttgcatacattatgcattgt |
158 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
1202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 22974 - 22924
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
22974 |
cggggtttgaacctcggaccttgcatattttatgcattgttcatatcaact |
22924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 18365 - 18299
Alignment:
| Q |
110 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||||| ||| || |||||||||| |||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
18365 |
ggtggtggccggaattcgaaccctggatcttgcatatattatacattgtccttaccaactgagctaa |
18299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0081 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0081
Description:
Target: scaffold0081; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 9025 - 8967
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaact |
169 |
Q |
| |
|
|||||| |||||||||||| || | || |||||||||||||||||||||| || ||||| |
|
|
| T |
9025 |
gtggtgttcggggtttgaatcccgaactttgcatacattatgcattgtccttaccaact |
8967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0567 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0567
Description:
Target: scaffold0567; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 171
Target Start/End: Original strand, 7552 - 7589
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactga |
171 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7552 |
ggaccttgcatatattatgcattgtccataccaactga |
7589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0524 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0524
Description:
Target: scaffold0524; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 1304 - 1239
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||| |||| ||||||||| ||||||| ||| |||||||||||||| || |||||||| |||| |
|
|
| T |
1304 |
tggtggccgggatttgaaccccggaccttatatagattatgcattgtccttaacaactgagttaaa |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 145
Target Start/End: Complemental strand, 53499 - 53462
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcata |
145 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| |
|
|
| T |
53499 |
ttggtggtggtcggggtttgaatcccggaccttgcata |
53462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 177
Target Start/End: Complemental strand, 17550 - 17509
Alignment:
| Q |
136 |
accttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
17550 |
accttgcatatattatgcattgtccatgtcagctgagctaaa |
17509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 47255 - 47296
Alignment:
| Q |
135 |
gaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
47255 |
gaccttgcatattttatgcattgtccataccaactgagctaa |
47296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 145
Target Start/End: Original strand, 354627 - 354664
Alignment:
| Q |
108 |
ttggtggtggtcggggtttgaaccctggaccttgcata |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
354627 |
ttggtggtggtcggggtttgaaccctaaaccttgcata |
354664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0549 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0549
Description:
Target: scaffold0549; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 119 - 175
Target Start/End: Original strand, 8594 - 8650
Alignment:
| Q |
119 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
||||||| ||||| |||| |||||||| |||||||||||| || |||| |||||||| |
|
|
| T |
8594 |
cggggttcgaaccatggaacttgcatatattatgcattgttcaaatcagctgagcta |
8650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0318 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 2265 - 2329
Alignment:
| Q |
111 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagcta |
175 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||| |||||||||||||| || || |||||||| |
|
|
| T |
2265 |
gtggtggtcgggattcgaaccctaaaccttgcattaattatgcattgtccttaccagctgagcta |
2329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 37605 - 37541
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
|||||| |||| || |||||| |||||||||||| ||||||||||| |||| ||||| |||||| |
|
|
| T |
37605 |
tggtggccgggattcgaaccccggaccttgcatattttatgcattgttcataccaacttagctaa |
37541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 176
Target Start/End: Complemental strand, 5494 - 5431
Alignment:
| Q |
112 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||| ||||||||||||||| | |||| ||| |||||||||||| | || |||||||||||| |
|
|
| T |
5494 |
tggtggttggggtttgaaccctg-atcttggatatattatgcattgttcttaccaactgagctaa |
5431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0087 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0087
Description:
Target: scaffold0087; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 44759 - 44819
Alignment:
| Q |
117 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaaa |
177 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||| | ||||| ||||| |||||||||||| |
|
|
| T |
44759 |
gtcggagtttgaaccctagaccttgcatattttaagaattgtacatattaactgagctaaa |
44819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 134 - 174
Target Start/End: Complemental strand, 64307 - 64267
Alignment:
| Q |
134 |
ggaccttgcatacattatgcattgtccatatcaactgagct |
174 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
64307 |
ggaccttgcatatattatgcattgtccataccaattgagct |
64267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 176
Target Start/End: Complemental strand, 63508 - 63480
Alignment:
| Q |
148 |
ttatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
63508 |
ttatgcattgtccatatcaactgagctaa |
63480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 176
Target Start/End: Complemental strand, 70840 - 70812
Alignment:
| Q |
148 |
ttatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
70840 |
ttatgcattgtccatatcaactgagctaa |
70812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 42337 - 42389
Alignment:
| Q |
124 |
tttgaaccctggaccttgcatacattatgcattgtccatatcaactgagctaa |
176 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
42337 |
tttgaaccccagaccttgcatatattatgcattgtccttcccaactgagctaa |
42389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University