View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_high_66 (Length: 234)
Name: NF1627_high_66
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_high_66 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 42508970 - 42509203
Alignment:
| Q |
1 |
agagccatcatcgactctagagaatccaccttcaggccactacaacaacaaaaaagttggaagtgaaagagatattgataatgaaagtaatagatcatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42508970 |
agagccatcatcgactctagagaatccaccttcaggccactacaacaacaaaaaagttggaagtgaaagagatattgatgatgaaagtaatagatcatca |
42509069 |
T |
 |
| Q |
101 |
agatcaatgagttccaatcacagtagaagaaatgatcacatgaagttgtcttttataagagatgacagagagaggtttgatttgcaagagttgctgagag |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42509070 |
agatcaatgagttccaaccacagtagaagaaatgatcacatgaagttgtcttttataagagatgacagagagaggtttgatttgcaagagttgctgagag |
42509169 |
T |
 |
| Q |
201 |
cttctgctgagattttgggaagtggtttttatag |
234 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
42509170 |
cttctgccgagattttgggaagtggtttttatag |
42509203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University