View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_high_67 (Length: 233)
Name: NF1627_high_67
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_high_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 4921214 - 4921415
Alignment:
| Q |
18 |
acaaaatgtgttgaatcatgaaatattatgttgaattactgtccaataatatcaataaaccataaaaaccatacattagaatcagttttagcttagaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4921214 |
acaaaatgtgttgaatcatgaaatattatgttgaattactgtccaataatatcaataaaccataaaaaccatacattagaatcagttttagcttagaaaa |
4921313 |
T |
|
| Q |
118 |
tggtttgatacttacattttacccatgatgtcattttttcccaacgtgtttccgtcgttttgcttcttttcatgttttatgatgaaatgtaggcttgatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4921314 |
tggtttgatacttacattttacccatgatgtcattttttcccaacgtgtgtccgtcgttttgcttcttttcatgttttatgatgaaatgtaggcttgatt |
4921413 |
T |
|
| Q |
218 |
tt |
219 |
Q |
| |
|
|| |
|
|
| T |
4921414 |
tt |
4921415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 95 - 187
Target Start/End: Original strand, 4927510 - 4927603
Alignment:
| Q |
95 |
agaatcagttttagcttagaaaatggtttgatacttacattttacccatgatgtca-ttttttcccaacgtgtttccgtcgttttgcttctttt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4927510 |
agaatcagttttagcttagaaaatggtttgatacttacattttacccatgatgtcatttttttcccaacgtgtttccgtcgttttgcttctttt |
4927603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 219
Target Start/End: Original strand, 4927624 - 4927657
Alignment:
| Q |
186 |
ttcatgttttatgatgaaatgtaggcttgatttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4927624 |
ttcatgttttatgatgaaatgtaggcttgatttt |
4927657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University