View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_high_69 (Length: 221)
Name: NF1627_high_69
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 160
Target Start/End: Complemental strand, 8591080 - 8591037
Alignment:
| Q |
117 |
ataatgaactcttgcatattctcaccaataataatgatcccctc |
160 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8591080 |
ataatcaactcttgcatattctcaccaataataatgatcacctc |
8591037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University