View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_21 (Length: 474)
Name: NF1627_low_21
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 450; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 450; E-Value: 0
Query Start/End: Original strand, 1 - 466
Target Start/End: Original strand, 37262949 - 37263414
Alignment:
| Q |
1 |
cacactgatgaattagaagatgtatgtggtgaagaagcagccgcatacactataaacaattcatttataacattccaccaatccaacaagccttaattac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37262949 |
cacactgatgaattagaagatgtatgtggtgaagaagcagccgcatacactataaacaattcatttataacattccaccaatccaacaagccttaactac |
37263048 |
T |
 |
| Q |
101 |
tatcgttgataacaataattcaccaccatggcttcagtgaagcaaaacagtgctgaagaaccactattgttcaaccacagtggtacatctcagaagcacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37263049 |
tatcgttgataacaataattcaccaccatggcttcattgaagcaaaacagtgctgaagaaccactattgttcaaccacagtggtacatctcagaagcacc |
37263148 |
T |
 |
| Q |
201 |
atgaatctgatggtgagcttgaaaggatactatcagacaccaccgtgccattcttcagccgtatctgctccgccacatggattgagctcagactcctttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37263149 |
atgaatctgatggtgagcttgaaaggatactatcagacaccaccgtgccattcttcagccgtatcggctccgccacatggattgagctcagactcctttt |
37263248 |
T |
 |
| Q |
301 |
cttgttggctgcaccagctgtttttgtttatcttattaattatgttatgtctatgtccacacaaatcttttccggccaccttggtaatcttgaacttgcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37263249 |
cttgttggctgcaccagctgtttttgtttatcttattaattatgttatgtctatgtccacacaaatcttttccggccaccttggtaatcttgaacttgcc |
37263348 |
T |
 |
| Q |
401 |
gcggcgtctctgggaaacaccgggattcaaatctttgcttatggtctcatggtaagtattcatctc |
466 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37263349 |
gcggcgtctctggggaacaccgggattcaaatctttgcttatggtctcatggtaagtattcatctc |
37263414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University