View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_33 (Length: 365)
Name: NF1627_low_33
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 342
Target Start/End: Complemental strand, 4292859 - 4292532
Alignment:
| Q |
15 |
tgttctttggtagtgacacttggcctgaatggcctatatagtggagctgctccacatacctgctagcatgcattaacatctattgatgggggccctgacg |
114 |
Q |
| |
|
||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||| | | ||||||| |
|
|
| T |
4292859 |
tgttcttctgtactgacacttggcctgataggcctatatagtggagctgctccacattcctgctagcatgcatcaacatctgctgattgtgaccctgaca |
4292760 |
T |
|
| Q |
115 |
ctttaaaatggaactcttatgtgggtggtacttttacaaacaggcttgcctatgctcctctggttggttcagctgctctgagacttctagtccttttttc |
214 |
Q |
| |
|
| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4292759 |
ccttaaaatgaaactcttatgtgggtggtaattttacaaacaggcttgcctatgctcctctggttggttcagctgctctgagacttctggtccttttttc |
4292660 |
T |
|
| Q |
215 |
ttgcactgccttccaataaggacacttcatgggttaacagtagtaatatttttcttcttggatcttgtagtaattatgtcagagttgttgccagcctgat |
314 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4292659 |
ttgcattgccttccaataatgacacttcatgggttaacagtagtaatattttgcttcttggatcttgtagtaattatgttagagttgttgccagcctgat |
4292560 |
T |
|
| Q |
315 |
ttttggggctcttatgctttttcgattt |
342 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
4292559 |
tttttgggctcttatgctttttcgattt |
4292532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University