View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_42 (Length: 306)
Name: NF1627_low_42
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 26439389 - 26439100
Alignment:
| Q |
1 |
tatatttgaacaatcaaccttcgaaaagtttgttaaaaatacaactgacttaaaggagcttttgcttgactacatagacatgtcttcaattaaaccaagc |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26439389 |
tatatttgaacaatcaaccttcaaaaagttcattaaaaatacaactgacttaaaggagcttttgcttgacaacatagacatgtcttcaattaaaccaagc |
26439290 |
T |
|
| Q |
101 |
tctctgtctttgcttgtaaattattcagcctctctagtctcccttagtctatatgataacaaattgcaagggaagttagcaagcaacctgctccatttac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26439289 |
tctctgtctttgcttgtaaattattcagcctctctagtctcccttagtctagaaggtaacaaattgcaagggaagttagcaagcaacctgcttcatttac |
26439190 |
T |
|
| Q |
201 |
ccaatcttcaatttcttaatctagcttcaaattttgatctcgaaagtgaactttcaaaagctaattggagcacttctctcgtgcacttgg |
290 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
26439189 |
ctaatcttcaatttcttaatctagcttcgaattttaatctcaaaagtgaactttcaaaagttaattggagtacttctctcgtgcacttgg |
26439100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University