View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_55 (Length: 259)
Name: NF1627_low_55
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 38752561 - 38752377
Alignment:
| Q |
1 |
cttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccaacaacaggtttgttcatctctcgtgatcttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38752561 |
cttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccagcaacaggtttgttcatctctcgtgatcttaaa |
38752462 |
T |
 |
| Q |
101 |
ctgaaaaccctagatggtatacgcttacannnnnnnnctcttcataattgcaaagaagaatttaaattaattaattaacaatagt |
185 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752461 |
ctgaaaaccctagatggtatacgtttacattttttttctcttcataattgcaaagaagaatttaaattaattaattaacaatagt |
38752377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 240
Target Start/End: Complemental strand, 38752340 - 38752312
Alignment:
| Q |
212 |
aatatatttgacaaaatcacgatggcatc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38752340 |
aatatatttgacaaaatcacgatggcatc |
38752312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 30904159 - 30904236
Alignment:
| Q |
1 |
cttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccaacaacaggttt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||| || ||||||||||||| |
|
|
| T |
30904159 |
cttatgaagctcaagctagacttcaagatcctatttatggatgtgtttcacatatttttgccctacaacaacaggttt |
30904236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University