View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_57 (Length: 252)
Name: NF1627_low_57
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 32464357 - 32464140
Alignment:
| Q |
15 |
aatactactactacaatactacacatctcattgaaagtcacaggaacaaactttaattttctgagtctgagtccttacactcttctctctcaagagcccg |
114 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32464357 |
aatactactactacagtattacacatctcattgaaagtcacag-aacaaactttaattttatgagtctgagtccttatactcttctctctcaagagccca |
32464259 |
T |
|
| Q |
115 |
-tcaaggtcttcaccgcgtttgtccacgagtttctctcatctataagaacgtcgtcttcaaattcaggtggaaaaggtaatctttttagctttattactt |
213 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32464258 |
atcaaggtcttcaccgcatttatccacaagtttctctcatctataagaacgtcatcttcaaagtcaaatggaaaaggtaatctttttagctttattactt |
32464159 |
T |
|
| Q |
214 |
agtgttaccattgtctcct |
232 |
Q |
| |
|
| | ||||||||||||||| |
|
|
| T |
32464158 |
actattaccattgtctcct |
32464140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University