View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1627_low_72 (Length: 221)

Name: NF1627_low_72
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1627_low_72
NF1627_low_72
[»] chr3 (1 HSPs)
chr3 (1-221)||(35112678-35112898)


Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 35112678 - 35112898
Alignment:
1 aggttttgacagaaaaccttgtttggtttgtagaataacaaccttaacacacctcaagatagacccaaagctgcaacgaaaattgcagtcataacacacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35112678 aggttttgacagaaaaccttgtttggtttgtagaataacaaccttaacacacctcaagatagacccaaagctgcaacgaaaattgcagtcataacacacc 35112777  T
101 tnnnnnnnccaaagccgaaacactcttctagggtaagcaaagaaaaacatactacaaacaaacttaatcactaaccataaaacatcccagcagctatcga 200  Q
    |       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35112778 tcaaaaaaccaaagccgaaacactcttctagggtaagcaaagaaaaacatactacaaacaaacttaatcactaaccataaaacatcccagcagctatcga 35112877  T
201 gatattgaatagggtaggaaa 221  Q
    ||| |||||||||||||||||    
35112878 gatcttgaatagggtaggaaa 35112898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University