View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_73 (Length: 216)
Name: NF1627_low_73
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 26885788 - 26885967
Alignment:
| Q |
17 |
cataggcacatacttctcccacatatgatccaccgtcatacaggtatacgataacctacgaagaagaataaaacatcatagtcatcttgactataatgca |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26885788 |
cataggcacatacttctcctacatatgatccaccatcatacaggtatacgataacctacgaagaagaataaaacatcatagtcatcttgactatgatgca |
26885887 |
T |
|
| Q |
117 |
gatgcaatgcctgcctaatcatcaagttataaataaacacgaaccaaccttaagactatctgccaaagtatcgtccagga |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26885888 |
gatgcaatgcctgcctaatcatcaatttataaataaacacgaaccaaccttaagactatctgccaaagtatcgtccagga |
26885967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 26631581 - 26631508
Alignment:
| Q |
17 |
cataggcacatacttctcccacatatgatccaccgtcatacaggtatacgataacctacgaagaagaataaaac |
90 |
Q |
| |
|
||||||||| ||||| |||| | ||||||| ||||||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
26631581 |
cataggcacgtacttgtccctcgtatgatcgaccgtcatacaggaatatcttaacctacaaagaagaataaaac |
26631508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University