View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1627_low_75 (Length: 210)
Name: NF1627_low_75
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1627_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 40580429 - 40580251
Alignment:
| Q |
15 |
atgaactttgtttcatgtatcagannnnnnnctgatttttcgaacgttgatatatcaaatgatgaaacctgtattcacnnnnnnnntcattaaatagtat |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40580429 |
atgaactttgtttcatgtatcagatttttttctgattttccgaacgttgatatatcaaatgatgaaacctgtattcacaaaaaaaatcattaaatagtat |
40580330 |
T |
 |
| Q |
115 |
tcgattttctatttgctgaatcaatgaatttgcatgtgattactggaatcatgttttgtttggggttggtgataagtgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40580329 |
tcgattttctatttgctgaatcaatgaatttgcatgtgattactggaatcatgttttgtttggggttggtgataagtgt |
40580251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University