View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1628-INSERTION-4 (Length: 86)
Name: NF1628-INSERTION-4
Description: NF1628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1628-INSERTION-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 27744846 - 27744793
Alignment:
| Q |
32 |
gtgggtgaatgaaggttagtaaagtggtgattgcatttctcccttcactttacta |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
27744846 |
gtgggtgaatgaaggttagtaaagtggtg-ttacttttctcccttcactttacta |
27744793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 32844546 - 32844508
Alignment:
| Q |
8 |
aggagtttgtgaacaaaggagtgggtgggtgaatgaagg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32844546 |
aggagtttgtgaacaaaggagtgggtgggtgaatgaagg |
32844508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University