View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16280_high_8 (Length: 201)
Name: NF16280_high_8
Description: NF16280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16280_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 9072712 - 9072528
Alignment:
| Q |
1 |
ctcattctcttcgtatcccctttgagttccaccctgttggagaacaacttgaggatcttaaaccacacatgtttaaccgtcgtgtaggcgaggctttggc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9072712 |
ctcattctcttcgtatcccctttgaattccaccctgttggagaacaacttgaagatcttaaaccacacatgtttaaccgccgtgtaggcgaggctttggc |
9072613 |
T |
 |
| Q |
101 |
ggttaacaccgttaaccgtctccaccgtgttcccgggaatcatctcgggaacttgttgtccatgataagagaccaagcaccaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072612 |
ggttaacaccgttaaccgtctccaccgtgttcccgggaatcatctcgggaacttgttgtccatgataagagaccaagcaccaaac |
9072528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University