View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16280_low_7 (Length: 241)
Name: NF16280_low_7
Description: NF16280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16280_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 47077411 - 47077623
Alignment:
| Q |
19 |
tatcccgcaatatccgttcacgtggctgagtagtgtttggactcttactaagttacatacacttaaattcttatgatcgcattttccaaaaaatgtgata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47077411 |
tatcccgcaatatccgttcacgtggctgagtagtgtttggactcttactaatttacatacacttaaattcttatgatcgcattttccaaaaaatgtgata |
47077510 |
T |
|
| Q |
119 |
ataatgtacttgttgttgttgatgtaatactctcctctatagtccttctcctattcagcttaatatatccttcactgcagccttttcatttcccttctcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47077511 |
ataatgtacttgttgttgttgatgtaatactctcctctatagtccttctcctattcagcttaatatatccttcactgcagccttttcatttcccttcccc |
47077610 |
T |
|
| Q |
219 |
tatctgtgctgct |
231 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
47077611 |
tatctgagctgct |
47077623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University