View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16281_high_17 (Length: 373)
Name: NF16281_high_17
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16281_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 48 - 269
Target Start/End: Original strand, 41741041 - 41741262
Alignment:
| Q |
48 |
tgttgccgtagaggaaaacaggtttgttacagtggacggaaatggcagcggcggtgatgatggtgaggggtttgaaggcacggcggagacgggaaggttg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
41741041 |
tgttgccgtagaggaaaacaggtttgttacagtggacggaaatggcagcggcggtgatgatggtgaggggtttgaaggcaaggcggcgacgggaaggttg |
41741140 |
T |
 |
| Q |
148 |
agagtagttgttgttgcatttagggagagaaggtttgttgttgtttttgcgagggccggaaaagatgttgttggatggaacaagagaagacatgttttgc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41741141 |
agagtagttgttgttgcatttagggagagaaggtttgttgttgtttttgcgagggccggaaaagatgttgttggatggaacaagagaagacatgttttgc |
41741240 |
T |
 |
| Q |
248 |
agttgagaaggtgatagctgca |
269 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41741241 |
agttgagaaggtgatagctgca |
41741262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 323 - 354
Target Start/End: Original strand, 41741312 - 41741343
Alignment:
| Q |
323 |
ggttttgaaagggtttttggttcccaaaatca |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41741312 |
ggttttgaaagggtttttggttcccaaaatca |
41741343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University